Regulon of CopR in Lactococcus lactis subsp. lactis Il1403

Properties
Regulator type:	Transcription factor
TF locus tag:	L45109
Regulator family:	CopY
Regulation mode:	repressor
Biological process:	Copper homeostasis
Effector:	Copper ion, (Cu2+)
Regulog:	CopR - Streptococcaceae
Statistics of regulated genes:
- Genes	10
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 39 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - CopY
By effector - Copper ion, (Cu2+)
By pathway - Copper homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -62 Score: 6.1 Sequence: TAGTTTACAATTGTAAACTA Locus tag: L70979 Name: copB Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4)
	L70979	copB	Copper-translocating P-type ATPase (EC 3.6.3.4)
Position: -73 Score: 6.2 Sequence: TAGTTTACAAGTGTAAATTT Position: -46 Score: 5.6 Sequence: AAGATTACATATGTAAACAA Locus tag: L174788 Name: cinD Funciton: Copper-induced nitroreductase
	L174788	cinD	Copper-induced nitroreductase
Position: -45 Score: 5.9 Sequence: TCGTTTACAATTGTAAACAT Locus tag: L200005 Name: yahC Funciton: Hypothetical protein Locus tag: L79507 Name: yahD Funciton: Copper-inducible alpha/beta serine hydrolase Locus tag: L80191 Name: yaiA Funciton: Glyoxalase family protein Locus tag: L81206 Name: yaiB Funciton: Hypothetical protein
	L200005	yahC	Hypothetical protein
	L79507	yahD	Copper-inducible alpha/beta serine hydrolase
	L80191	yaiA	Glyoxalase family protein
	L81206	yaiB	Hypothetical protein
Position: -53 Score: 5.5 Sequence: GTGTTTACACGTGTAAACTT Locus tag: L45109 Name: copR Funciton: Copper transport transcriptional regulator CopR, CopY family Locus tag: L45583 Name: copZ Funciton: Copper chaperone Locus tag: L45966 Name: copA Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4)
	L45109	copR	Copper transport transcriptional regulator CopR, CopY family
	L45583	copZ	Copper chaperone
	L45966	copA	Copper-translocating P-type ATPase (EC 3.6.3.4)
Position: -106 Score: 5.8 Sequence: ATGTTTACATGTGTAAATTT Locus tag: L186107 Name: ydiD Funciton: FMN-dependent NADH-azoreductase
	L186107	ydiD	FMN-dependent NADH-azoreductase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD