Regulog IscR - Alteromonadales
| Regulator type: | Transcription factor |
| Regulator family: | Rrf2 |
| Regulation mode: | activator (repressor) |
| Biological process: | Iron-sulfur cluster biogenesis |
| Effector: | Iron-sulfur cluster redox state |
| Phylum: | Proteobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Alteromonadales
- By trascription factor - IscR
- By TF family - Rrf2
- By effector - Iron-sulfur cluster redox state
- By pathway - Iron-sulfur cluster biogenesis
| Genome | Genes | Operons |
|---|---|---|
| Pseudoalteromonas atlantica T6c | 9 | 3 |
| Alteromonas macleodii 'Deep ecotype' | 10 | 3 |
| Glaciecola sp. HTCC2999 | 9 | 3 |
| Colwellia psychrerythraea 34H | 11 | 4 |
| Alteromonadales bacterium TW-7 | 11 | 4 |
| Pseudoalteromonas haloplanktis TAC125 | 11 | 4 |
| Pseudoalteromonas tunicata D2 | 11 | 4 |
| Idiomarina baltica OS145 | 10 | 3 |
| Idiomarina loihiensis L2TR | 12 | 5 |
| Genes | Function | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||
| sufB |
|
*
Alteromonas macleodii 'Deep ecotype' Site: position = -227 score = 6.55192 sequence = ATATTTGAGTGAAATAGTCGGGTAT Gene: MADE_01357: Iron-sulfur cluster assembly protein SufB |
|
|
|
|
|
*
Idiomarina baltica OS145 Site: position = -65 score = 5.77568 sequence = AAAGTTGAGTGTTTTACTCGGGTAT Gene: OS145_02725: Iron-sulfur cluster assembly protein SufB |
*
Idiomarina loihiensis L2TR Site: position = -86 score = 5.88058 sequence = AAAGTTGAGTGTTTTAGTCAGGTAT Gene: IL0154: Iron-sulfur cluster assembly protein SufB |
Iron-sulfur cluster assembly protein SufB |
| sufC |
|
Gene: MADE_01358: Iron-sulfur cluster assembly ATPase protein SufC |
|
|
|
|
|
Gene: OS145_02730: Iron-sulfur cluster assembly ATPase protein SufC |
Gene: IL0153: Iron-sulfur cluster assembly ATPase protein SufC |
Iron-sulfur cluster assembly ATPase protein SufC |
| sufD |
|
Gene: MADE_01359: Iron-sulfur cluster assembly protein SufD |
|
|
|
|
|
Gene: OS145_02735: Iron-sulfur cluster assembly protein SufD |
Gene: IL0152: Iron-sulfur cluster assembly protein SufD |
Iron-sulfur cluster assembly protein SufD |
| sufS |
|
Gene: MADE_01360: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily |
|
|
|
|
|
Gene: OS145_02740: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily |
Gene: IL0151: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily |
Cysteine desulfurase (EC 2.8.1.7), SufS subfamily |
| sufA |
|
Gene: MADE_01361: Iron binding protein SufA for iron-sulfur cluster assembly |
|
|
|
|
|
Gene: OS145_02745: Iron binding protein SufA for iron-sulfur cluster assembly |
Gene: IL0150: Iron binding protein SufA for iron-sulfur cluster assembly |
Iron binding protein SufA for iron-sulfur cluster assembly |
| sufT |
|
Gene: MADE_01362: Iron sulfur cluster assembly protein SufT |
|
|
|
|
|
Gene: OS145_02750: Iron sulfur cluster assembly protein SufT |
Gene: IL0149: Iron sulfur cluster assembly protein SufT |
Iron sulfur cluster assembly protein SufT |
| sufE |
|
Gene: MADE_01363: Sulfur acceptor protein SufE for iron-sulfur cluster assembly |
|
|
|
|
|
Gene: OS145_02755: Sulfur acceptor protein SufE for iron-sulfur cluster assembly |
Gene: IL0148: Sulfur acceptor protein SufE for iron-sulfur cluster assembly |
Sulfur acceptor protein SufE for iron-sulfur cluster assembly |
| CRON 2. | ||||||||||
| erpA |
*
Pseudoalteromonas atlantica T6c Site: position = -118 score = 6.16214 sequence = ATAGTTGATAAGATTAGTCAGGTAT Gene: Patl_0544: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family |
Gene: MADE_01609: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family |
*
Glaciecola sp. HTCC2999 Site: position = -66 score = 6.55756 sequence = ATACTTGATGAATTTACTCAAGTAT Gene: GHTCC_010100001060: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family |
*
Colwellia psychrerythraea 34H Site: position = -101 score = 6.85803 sequence = ATACTTGACTAAAATAGTCAAGTTT Gene: CPS_4622: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family |
*
Alteromonadales bacterium TW-7 Site: position = -62 score = 6.93127 sequence = ATACTTGATTAAAACACTCGGGTAT Gene: ATW7_10453: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family |
*
Pseudoalteromonas haloplanktis TAC125 Site: position = -62 score = 6.93127 sequence = ATACTTGATTAAAACACTCGGGTAT Gene: PSHAa2251: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family |
*
Pseudoalteromonas tunicata D2 Site: position = -62 score = 6.64485 sequence = GTACTTGATTAAAACACTCGGGTAT Gene: PTD2_12764: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family |
Gene: OS145_07926: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family |
*
Idiomarina loihiensis L2TR Site: position = -64 score = 6.94214 sequence = ATACTTGACCAAAATACTCAGGTAA Gene: IL2240: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family |
ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family |
| CRON 3. | ||||||||||
| nfuA |
*
Pseudoalteromonas atlantica T6c Site: position = -68 score = 6.09353 sequence = TTACTTGAGTGTTTTAGTCAAGTAA Gene: Patl_4233: NfuA Fe-S protein maturation |
*
Alteromonas macleodii 'Deep ecotype' Site: position = -69 score = 6.54888 sequence = ATACCTGACTGTTTTAGTCAGGTAA Gene: MADE_03996: NfuA Fe-S protein maturation |
*
Glaciecola sp. HTCC2999 Site: position = -72 score = 6.73471 sequence = ATACTTGACTGTTTTAGTCGGGTAA Gene: GHTCC_010100008811: NfuA Fe-S protein maturation |
*
Colwellia psychrerythraea 34H Site: position = -94 score = 7.11028 sequence = ATACTTGAGTAAAACAGTCAGGTAT Gene: CPS_0220: NfuA Fe-S protein maturation |
*
Alteromonadales bacterium TW-7 Site: position = -37 score = 6.18931 sequence = GTATCCGAGTAATTTAGTCAGGTAT Gene: ATW7_17107: NfuA Fe-S protein maturation |
*
Pseudoalteromonas haloplanktis TAC125 Site: position = -35 score = 5.99505 sequence = GTATCCGAGTAATTTAGTCAAGTAT Gene: PSHAa2860: NfuA Fe-S protein maturation |
*
Pseudoalteromonas tunicata D2 Site: position = -35 score = 6.06979 sequence = ATACCCGAGTATTTTAGTCAACTAT Gene: PTD2_16836: NfuA Fe-S protein maturation |
*
Idiomarina baltica OS145 Site: position = -40 score = 5.16699 sequence = AAAACCTAGTAAATTACTCAAGTAT Gene: OS145_02245: NfuA Fe-S protein maturation |
*
Idiomarina loihiensis L2TR Site: position = -45 score = 6.33135 sequence = ATACCCTAGTAATTTACTCAGGTAT Gene: IL0248: NfuA Fe-S protein maturation |
NfuA Fe-S protein maturation |
| CPS_0221 |
|
|
|
Gene: CPS_0221: Conserved hypothetical protein |
Gene: ATW7_17102: Conserved hypothetical protein |
Gene: PSHAa2861: Conserved hypothetical protein |
Gene: PTD2_16841: Conserved hypothetical protein |
|
|
Conserved hypothetical protein |
| CRON 4. | ||||||||||
| iscR |
*
Pseudoalteromonas atlantica T6c Site: position = -87 score = 6.45238 sequence = ATACTTGACTAAAACAGTAGGATAA Site: position = -62 score = 7.01621 sequence = ATACTTGACTAAAATAGTCGGGTTT Gene: Patl_1237: Iron-sulfur cluster regulator IscR |
*
Alteromonas macleodii 'Deep ecotype' Site: position = -88 score = 6.07992 sequence = ATACTTGACTAATTTACTGGGTTTT Site: position = -63 score = 6.87461 sequence = ATACTTGACCATTTTAGTCAGGTAT Gene: MADE_01355: Iron-sulfur cluster regulator IscR |
*
Glaciecola sp. HTCC2999 Site: position = -62 score = 7.28547 sequence = ATACTTGACTAATTTAGTCGGGTAA Site: position = -87 score = 6.95097 sequence = ATACTTGACTAAATTAGTCGGTTAA Gene: GHTCC_010100002924: Iron-sulfur cluster regulator IscR |
*
Colwellia psychrerythraea 34H Site: position = -199 score = 6.52508 sequence = ATACCTGAGTAAATCACTAGGGTAT Site: position = -254 score = 6.26262 sequence = ATAGTTGAGTAAAACAGTCAACTAT Gene: CPS_1131: Iron-sulfur cluster regulator IscR |
*
Alteromonadales bacterium TW-7 Site: position = -57 score = 6.99178 sequence = ATACTTGACTAATTTACTCTGGTAA Site: position = -148 score = 6.02959 sequence = ATACTTGACCAAACAGGTCAGGTAT Site: position = -187 score = 7.3039 sequence = ATACTTGACTAAATTACTCAGGTAA Gene: ATW7_18135: Iron-sulfur cluster regulator IscR |
*
Pseudoalteromonas haloplanktis TAC125 Site: position = -58 score = 6.99178 sequence = ATACTTGACTAATTTACTCTGGTAA Site: position = -117 score = 7.04145 sequence = ATACTTGAGTAAAACACTCAGGTAT Site: position = -157 score = 7.3039 sequence = ATACTTGACTAAATTACTCAGGTAA Gene: PSHAa2672: Iron-sulfur cluster regulator IscR |
*
Pseudoalteromonas tunicata D2 Site: position = -107 score = 7.33665 sequence = ATACTTGACTAAATTAGTCGGGTAA Site: position = -149 score = 7.38783 sequence = ATACTTGACTAAATTAGTCGGGTAT Site: position = -66 score = 6.41803 sequence = ATACTTGACTCTTTTAGTCAGGTTA Gene: PTD2_13944: Iron-sulfur cluster regulator IscR |
*
Idiomarina baltica OS145 Site: position = -75 score = 6.62253 sequence = ATACTTGACTAATTTAGTCGGAAAA Gene: OS145_04890: Iron-sulfur cluster regulator IscR |
*
Idiomarina loihiensis L2TR Site: position = -74 score = 6.96874 sequence = ATACTTGACTAAAATAGTCGGGAAT Gene: IL2041: Iron-sulfur cluster regulator IscR |
Iron-sulfur cluster regulator IscR |
| iscS |
Gene: Patl_1238: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: MADE_01356: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: GHTCC_010100002929: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: CPS_1132: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: ATW7_18140: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: PSHAa2671: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: PTD2_13939: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: OS145_04885: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: IL2040: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
| iscU |
Gene: Patl_1239: Iron-sulfur cluster assembly scaffold protein IscU |
|
Gene: GHTCC_010100002934: Iron-sulfur cluster assembly scaffold protein IscU |
Gene: CPS_1133: Iron-sulfur cluster assembly scaffold protein IscU |
Gene: ATW7_18145: Iron-sulfur cluster assembly scaffold protein IscU |
Gene: PSHAa2670: Iron-sulfur cluster assembly scaffold protein IscU |
Gene: PTD2_13934: Iron-sulfur cluster assembly scaffold protein IscU |
|
|
Iron-sulfur cluster assembly scaffold protein IscU |
| iscA |
Gene: Patl_1240: Iron binding protein IscA for iron-sulfur cluster assembly |
|
Gene: GHTCC_010100002939: Iron binding protein IscA for iron-sulfur cluster assembly |
Gene: CPS_1134: Iron binding protein IscA for iron-sulfur cluster assembly |
Gene: ATW7_18150: Iron binding protein IscA for iron-sulfur cluster assembly |
Gene: PSHAa2669: Iron binding protein IscA for iron-sulfur cluster assembly |
Gene: PTD2_13929: Iron binding protein IscA for iron-sulfur cluster assembly |
|
|
Iron binding protein IscA for iron-sulfur cluster assembly |
| hscB |
Gene: Patl_1241: Chaperone protein HscB |
|
Gene: GHTCC_010100002944: Chaperone protein HscB |
Gene: CPS_1135: Chaperone protein HscB |
Gene: ATW7_18155: Chaperone protein HscB |
Gene: PSHAa2668: Chaperone protein HscB |
Gene: PTD2_13924: Chaperone protein HscB |
|
|
Chaperone protein HscB |
| hscA |
Gene: Patl_1242: Chaperone protein HscA |
|
Gene: GHTCC_010100002949: Chaperone protein HscA |
Gene: CPS_1136: Chaperone protein HscA |
Gene: ATW7_18160: Chaperone protein HscA |
Gene: PSHAa2667: Chaperone protein HscA |
Gene: PTD2_13919: Chaperone protein HscA |
|
|
Chaperone protein HscA |
| fdx |
Gene: Patl_1243: ferredoxin, 2Fe-2S type, ISC system |
|
Gene: GHTCC_010100002954: ferredoxin, 2Fe-2S type, ISC system |
Gene: CPS_1137: ferredoxin, 2Fe-2S type, ISC system |
Gene: ATW7_18165: ferredoxin, 2Fe-2S type, ISC system |
Gene: PSHAa2666: ferredoxin, 2Fe-2S type, ISC system |
Gene: PTD2_13914: ferredoxin, 2Fe-2S type, ISC system |
|
|
ferredoxin, 2Fe-2S type, ISC system |
| CRON 5. | ||||||||||
| ydhD |
Gene: Patl_1396: Probable monothiol glutaredoxin ydhD |
Gene: MADE_02749: Probable monothiol glutaredoxin ydhD |
Gene: GHTCC_010100007517: Probable monothiol glutaredoxin ydhD |
*
Colwellia psychrerythraea 34H Site: position = -216 score = 6.4683 sequence = AAACTTGAGTAAAATACTCAAGTAT Gene: CPS_3475: Probable monothiol glutaredoxin ydhD |
*
Alteromonadales bacterium TW-7 Site: position = -162 score = 5.66028 sequence = ATTGTTGAGTATTTTACTCAAGTTT Gene: ATW7_06868: Probable monothiol glutaredoxin ydhD |
*
Pseudoalteromonas haloplanktis TAC125 Site: position = -163 score = 5.31576 sequence = ATTGTTGAGTATTCTACTCAAGTTT Gene: PSHAa1216: Probable monothiol glutaredoxin ydhD |
*
Pseudoalteromonas tunicata D2 Site: position = -164 score = 4.99413 sequence = AATCCCGAGTATTTTACTCAAGTTT Gene: PTD2_10759: Probable monothiol glutaredoxin ydhD |
|
*
Idiomarina loihiensis L2TR Site: position = -44 score = 5.02314 sequence = ATACCTGAGTGTTTTAATCAACCAT Gene: IL1804: Probable monothiol glutaredoxin ydhD |
Probable monothiol glutaredoxin ydhD |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |