Regulog IscR - Alteromonadales

Properties
Regulator type:	Transcription factor
Regulator family:	Rrf2
Regulation mode:	activator (repressor)
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Phylum:	Proteobacteria
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 43 sites [see more]

Member of regulog collections

By taxonomy - Alteromonadales
By trascription factor - IscR
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Statistics of regulated genes
Genome	Genes	Operons
Pseudoalteromonas atlantica T6c	9	3
Alteromonas macleodii 'Deep ecotype'	10	3
Glaciecola sp. HTCC2999	9	3
Colwellia psychrerythraea 34H	11	4
Alteromonadales bacterium TW-7	11	4
Pseudoalteromonas haloplanktis TAC125	11	4
Pseudoalteromonas tunicata D2	11	4
Idiomarina baltica OS145	10	3
Idiomarina loihiensis L2TR	12	5

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes										Function

CRON 1.
sufB	Pseudoalteromonas atlantica T6c	* Alteromonas macleodii 'Deep ecotype' Site: position = -227 score = 6.55192 sequence = ATATTTGAGTGAAATAGTCGGGTAT Gene: MADE_01357: Iron-sulfur cluster assembly protein SufB	Glaciecola sp. HTCC2999	Colwellia psychrerythraea 34H	Alteromonadales bacterium TW-7	Pseudoalteromonas haloplanktis TAC125	Pseudoalteromonas tunicata D2	* Idiomarina baltica OS145 Site: position = -65 score = 5.77568 sequence = AAAGTTGAGTGTTTTACTCGGGTAT Gene: OS145_02725: Iron-sulfur cluster assembly protein SufB	* Idiomarina loihiensis L2TR Site: position = -86 score = 5.88058 sequence = AAAGTTGAGTGTTTTAGTCAGGTAT Gene: IL0154: Iron-sulfur cluster assembly protein SufB	Iron-sulfur cluster assembly protein SufB
sufC	Pseudoalteromonas atlantica T6c	Alteromonas macleodii 'Deep ecotype' Gene: MADE_01358: Iron-sulfur cluster assembly ATPase protein SufC	Glaciecola sp. HTCC2999	Colwellia psychrerythraea 34H	Alteromonadales bacterium TW-7	Pseudoalteromonas haloplanktis TAC125	Pseudoalteromonas tunicata D2	Idiomarina baltica OS145 Gene: OS145_02730: Iron-sulfur cluster assembly ATPase protein SufC	Idiomarina loihiensis L2TR Gene: IL0153: Iron-sulfur cluster assembly ATPase protein SufC	Iron-sulfur cluster assembly ATPase protein SufC
sufD	Pseudoalteromonas atlantica T6c	Alteromonas macleodii 'Deep ecotype' Gene: MADE_01359: Iron-sulfur cluster assembly protein SufD	Glaciecola sp. HTCC2999	Colwellia psychrerythraea 34H	Alteromonadales bacterium TW-7	Pseudoalteromonas haloplanktis TAC125	Pseudoalteromonas tunicata D2	Idiomarina baltica OS145 Gene: OS145_02735: Iron-sulfur cluster assembly protein SufD	Idiomarina loihiensis L2TR Gene: IL0152: Iron-sulfur cluster assembly protein SufD	Iron-sulfur cluster assembly protein SufD
sufS	Pseudoalteromonas atlantica T6c	Alteromonas macleodii 'Deep ecotype' Gene: MADE_01360: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily	Glaciecola sp. HTCC2999	Colwellia psychrerythraea 34H	Alteromonadales bacterium TW-7	Pseudoalteromonas haloplanktis TAC125	Pseudoalteromonas tunicata D2	Idiomarina baltica OS145 Gene: OS145_02740: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily	Idiomarina loihiensis L2TR Gene: IL0151: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily	Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
sufA	Pseudoalteromonas atlantica T6c	Alteromonas macleodii 'Deep ecotype' Gene: MADE_01361: Iron binding protein SufA for iron-sulfur cluster assembly	Glaciecola sp. HTCC2999	Colwellia psychrerythraea 34H	Alteromonadales bacterium TW-7	Pseudoalteromonas haloplanktis TAC125	Pseudoalteromonas tunicata D2	Idiomarina baltica OS145 Gene: OS145_02745: Iron binding protein SufA for iron-sulfur cluster assembly	Idiomarina loihiensis L2TR Gene: IL0150: Iron binding protein SufA for iron-sulfur cluster assembly	Iron binding protein SufA for iron-sulfur cluster assembly
sufT	Pseudoalteromonas atlantica T6c	Alteromonas macleodii 'Deep ecotype' Gene: MADE_01362: Iron sulfur cluster assembly protein SufT	Glaciecola sp. HTCC2999	Colwellia psychrerythraea 34H	Alteromonadales bacterium TW-7	Pseudoalteromonas haloplanktis TAC125	Pseudoalteromonas tunicata D2	Idiomarina baltica OS145 Gene: OS145_02750: Iron sulfur cluster assembly protein SufT	Idiomarina loihiensis L2TR Gene: IL0149: Iron sulfur cluster assembly protein SufT	Iron sulfur cluster assembly protein SufT
sufE	Pseudoalteromonas atlantica T6c	Alteromonas macleodii 'Deep ecotype' Gene: MADE_01363: Sulfur acceptor protein SufE for iron-sulfur cluster assembly	Glaciecola sp. HTCC2999	Colwellia psychrerythraea 34H	Alteromonadales bacterium TW-7	Pseudoalteromonas haloplanktis TAC125	Pseudoalteromonas tunicata D2	Idiomarina baltica OS145 Gene: OS145_02755: Sulfur acceptor protein SufE for iron-sulfur cluster assembly	Idiomarina loihiensis L2TR Gene: IL0148: Sulfur acceptor protein SufE for iron-sulfur cluster assembly	Sulfur acceptor protein SufE for iron-sulfur cluster assembly

CRON 2.
erpA	* Pseudoalteromonas atlantica T6c Site: position = -118 score = 6.16214 sequence = ATAGTTGATAAGATTAGTCAGGTAT Gene: Patl_0544: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	Alteromonas macleodii 'Deep ecotype' Gene: MADE_01609: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	* Glaciecola sp. HTCC2999 Site: position = -66 score = 6.55756 sequence = ATACTTGATGAATTTACTCAAGTAT Gene: GHTCC_010100001060: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	* Colwellia psychrerythraea 34H Site: position = -101 score = 6.85803 sequence = ATACTTGACTAAAATAGTCAAGTTT Gene: CPS_4622: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	* Alteromonadales bacterium TW-7 Site: position = -62 score = 6.93127 sequence = ATACTTGATTAAAACACTCGGGTAT Gene: ATW7_10453: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	* Pseudoalteromonas haloplanktis TAC125 Site: position = -62 score = 6.93127 sequence = ATACTTGATTAAAACACTCGGGTAT Gene: PSHAa2251: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	* Pseudoalteromonas tunicata D2 Site: position = -62 score = 6.64485 sequence = GTACTTGATTAAAACACTCGGGTAT Gene: PTD2_12764: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	Idiomarina baltica OS145 Gene: OS145_07926: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	* Idiomarina loihiensis L2TR Site: position = -64 score = 6.94214 sequence = ATACTTGACCAAAATACTCAGGTAA Gene: IL2240: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family

CRON 3.
nfuA	* Pseudoalteromonas atlantica T6c Site: position = -68 score = 6.09353 sequence = TTACTTGAGTGTTTTAGTCAAGTAA Gene: Patl_4233: NfuA Fe-S protein maturation	* Alteromonas macleodii 'Deep ecotype' Site: position = -69 score = 6.54888 sequence = ATACCTGACTGTTTTAGTCAGGTAA Gene: MADE_03996: NfuA Fe-S protein maturation	* Glaciecola sp. HTCC2999 Site: position = -72 score = 6.73471 sequence = ATACTTGACTGTTTTAGTCGGGTAA Gene: GHTCC_010100008811: NfuA Fe-S protein maturation	* Colwellia psychrerythraea 34H Site: position = -94 score = 7.11028 sequence = ATACTTGAGTAAAACAGTCAGGTAT Gene: CPS_0220: NfuA Fe-S protein maturation	* Alteromonadales bacterium TW-7 Site: position = -37 score = 6.18931 sequence = GTATCCGAGTAATTTAGTCAGGTAT Gene: ATW7_17107: NfuA Fe-S protein maturation	* Pseudoalteromonas haloplanktis TAC125 Site: position = -35 score = 5.99505 sequence = GTATCCGAGTAATTTAGTCAAGTAT Gene: PSHAa2860: NfuA Fe-S protein maturation	* Pseudoalteromonas tunicata D2 Site: position = -35 score = 6.06979 sequence = ATACCCGAGTATTTTAGTCAACTAT Gene: PTD2_16836: NfuA Fe-S protein maturation	* Idiomarina baltica OS145 Site: position = -40 score = 5.16699 sequence = AAAACCTAGTAAATTACTCAAGTAT Gene: OS145_02245: NfuA Fe-S protein maturation	* Idiomarina loihiensis L2TR Site: position = -45 score = 6.33135 sequence = ATACCCTAGTAATTTACTCAGGTAT Gene: IL0248: NfuA Fe-S protein maturation	NfuA Fe-S protein maturation
CPS_0221	Pseudoalteromonas atlantica T6c	Alteromonas macleodii 'Deep ecotype'	Glaciecola sp. HTCC2999	Colwellia psychrerythraea 34H Gene: CPS_0221: Conserved hypothetical protein	Alteromonadales bacterium TW-7 Gene: ATW7_17102: Conserved hypothetical protein	Pseudoalteromonas haloplanktis TAC125 Gene: PSHAa2861: Conserved hypothetical protein	Pseudoalteromonas tunicata D2 Gene: PTD2_16841: Conserved hypothetical protein	Idiomarina baltica OS145	Idiomarina loihiensis L2TR	Conserved hypothetical protein

CRON 4.
iscR	* Pseudoalteromonas atlantica T6c Site: position = -87 score = 6.45238 sequence = ATACTTGACTAAAACAGTAGGATAA Site: position = -62 score = 7.01621 sequence = ATACTTGACTAAAATAGTCGGGTTT Gene: Patl_1237: Iron-sulfur cluster regulator IscR	* Alteromonas macleodii 'Deep ecotype' Site: position = -88 score = 6.07992 sequence = ATACTTGACTAATTTACTGGGTTTT Site: position = -63 score = 6.87461 sequence = ATACTTGACCATTTTAGTCAGGTAT Gene: MADE_01355: Iron-sulfur cluster regulator IscR	* Glaciecola sp. HTCC2999 Site: position = -62 score = 7.28547 sequence = ATACTTGACTAATTTAGTCGGGTAA Site: position = -87 score = 6.95097 sequence = ATACTTGACTAAATTAGTCGGTTAA Gene: GHTCC_010100002924: Iron-sulfur cluster regulator IscR	* Colwellia psychrerythraea 34H Site: position = -199 score = 6.52508 sequence = ATACCTGAGTAAATCACTAGGGTAT Site: position = -254 score = 6.26262 sequence = ATAGTTGAGTAAAACAGTCAACTAT Gene: CPS_1131: Iron-sulfur cluster regulator IscR	* Alteromonadales bacterium TW-7 Site: position = -57 score = 6.99178 sequence = ATACTTGACTAATTTACTCTGGTAA Site: position = -148 score = 6.02959 sequence = ATACTTGACCAAACAGGTCAGGTAT Site: position = -187 score = 7.3039 sequence = ATACTTGACTAAATTACTCAGGTAA Gene: ATW7_18135: Iron-sulfur cluster regulator IscR	* Pseudoalteromonas haloplanktis TAC125 Site: position = -58 score = 6.99178 sequence = ATACTTGACTAATTTACTCTGGTAA Site: position = -117 score = 7.04145 sequence = ATACTTGAGTAAAACACTCAGGTAT Site: position = -157 score = 7.3039 sequence = ATACTTGACTAAATTACTCAGGTAA Gene: PSHAa2672: Iron-sulfur cluster regulator IscR	* Pseudoalteromonas tunicata D2 Site: position = -107 score = 7.33665 sequence = ATACTTGACTAAATTAGTCGGGTAA Site: position = -149 score = 7.38783 sequence = ATACTTGACTAAATTAGTCGGGTAT Site: position = -66 score = 6.41803 sequence = ATACTTGACTCTTTTAGTCAGGTTA Gene: PTD2_13944: Iron-sulfur cluster regulator IscR	* Idiomarina baltica OS145 Site: position = -75 score = 6.62253 sequence = ATACTTGACTAATTTAGTCGGAAAA Gene: OS145_04890: Iron-sulfur cluster regulator IscR	* Idiomarina loihiensis L2TR Site: position = -74 score = 6.96874 sequence = ATACTTGACTAAAATAGTCGGGAAT Gene: IL2041: Iron-sulfur cluster regulator IscR	Iron-sulfur cluster regulator IscR
iscS	Pseudoalteromonas atlantica T6c Gene: Patl_1238: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Alteromonas macleodii 'Deep ecotype' Gene: MADE_01356: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Glaciecola sp. HTCC2999 Gene: GHTCC_010100002929: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Colwellia psychrerythraea 34H Gene: CPS_1132: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Alteromonadales bacterium TW-7 Gene: ATW7_18140: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Pseudoalteromonas haloplanktis TAC125 Gene: PSHAa2671: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Pseudoalteromonas tunicata D2 Gene: PTD2_13939: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Idiomarina baltica OS145 Gene: OS145_04885: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Idiomarina loihiensis L2TR Gene: IL2040: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
iscU	Pseudoalteromonas atlantica T6c Gene: Patl_1239: Iron-sulfur cluster assembly scaffold protein IscU	Alteromonas macleodii 'Deep ecotype'	Glaciecola sp. HTCC2999 Gene: GHTCC_010100002934: Iron-sulfur cluster assembly scaffold protein IscU	Colwellia psychrerythraea 34H Gene: CPS_1133: Iron-sulfur cluster assembly scaffold protein IscU	Alteromonadales bacterium TW-7 Gene: ATW7_18145: Iron-sulfur cluster assembly scaffold protein IscU	Pseudoalteromonas haloplanktis TAC125 Gene: PSHAa2670: Iron-sulfur cluster assembly scaffold protein IscU	Pseudoalteromonas tunicata D2 Gene: PTD2_13934: Iron-sulfur cluster assembly scaffold protein IscU	Idiomarina baltica OS145	Idiomarina loihiensis L2TR	Iron-sulfur cluster assembly scaffold protein IscU
iscA	Pseudoalteromonas atlantica T6c Gene: Patl_1240: Iron binding protein IscA for iron-sulfur cluster assembly	Alteromonas macleodii 'Deep ecotype'	Glaciecola sp. HTCC2999 Gene: GHTCC_010100002939: Iron binding protein IscA for iron-sulfur cluster assembly	Colwellia psychrerythraea 34H Gene: CPS_1134: Iron binding protein IscA for iron-sulfur cluster assembly	Alteromonadales bacterium TW-7 Gene: ATW7_18150: Iron binding protein IscA for iron-sulfur cluster assembly	Pseudoalteromonas haloplanktis TAC125 Gene: PSHAa2669: Iron binding protein IscA for iron-sulfur cluster assembly	Pseudoalteromonas tunicata D2 Gene: PTD2_13929: Iron binding protein IscA for iron-sulfur cluster assembly	Idiomarina baltica OS145	Idiomarina loihiensis L2TR	Iron binding protein IscA for iron-sulfur cluster assembly
hscB	Pseudoalteromonas atlantica T6c Gene: Patl_1241: Chaperone protein HscB	Alteromonas macleodii 'Deep ecotype'	Glaciecola sp. HTCC2999 Gene: GHTCC_010100002944: Chaperone protein HscB	Colwellia psychrerythraea 34H Gene: CPS_1135: Chaperone protein HscB	Alteromonadales bacterium TW-7 Gene: ATW7_18155: Chaperone protein HscB	Pseudoalteromonas haloplanktis TAC125 Gene: PSHAa2668: Chaperone protein HscB	Pseudoalteromonas tunicata D2 Gene: PTD2_13924: Chaperone protein HscB	Idiomarina baltica OS145	Idiomarina loihiensis L2TR	Chaperone protein HscB
hscA	Pseudoalteromonas atlantica T6c Gene: Patl_1242: Chaperone protein HscA	Alteromonas macleodii 'Deep ecotype'	Glaciecola sp. HTCC2999 Gene: GHTCC_010100002949: Chaperone protein HscA	Colwellia psychrerythraea 34H Gene: CPS_1136: Chaperone protein HscA	Alteromonadales bacterium TW-7 Gene: ATW7_18160: Chaperone protein HscA	Pseudoalteromonas haloplanktis TAC125 Gene: PSHAa2667: Chaperone protein HscA	Pseudoalteromonas tunicata D2 Gene: PTD2_13919: Chaperone protein HscA	Idiomarina baltica OS145	Idiomarina loihiensis L2TR	Chaperone protein HscA
fdx	Pseudoalteromonas atlantica T6c Gene: Patl_1243: ferredoxin, 2Fe-2S type, ISC system	Alteromonas macleodii 'Deep ecotype'	Glaciecola sp. HTCC2999 Gene: GHTCC_010100002954: ferredoxin, 2Fe-2S type, ISC system	Colwellia psychrerythraea 34H Gene: CPS_1137: ferredoxin, 2Fe-2S type, ISC system	Alteromonadales bacterium TW-7 Gene: ATW7_18165: ferredoxin, 2Fe-2S type, ISC system	Pseudoalteromonas haloplanktis TAC125 Gene: PSHAa2666: ferredoxin, 2Fe-2S type, ISC system	Pseudoalteromonas tunicata D2 Gene: PTD2_13914: ferredoxin, 2Fe-2S type, ISC system	Idiomarina baltica OS145	Idiomarina loihiensis L2TR	ferredoxin, 2Fe-2S type, ISC system

CRON 5.
ydhD	Pseudoalteromonas atlantica T6c Gene: Patl_1396: Probable monothiol glutaredoxin ydhD	Alteromonas macleodii 'Deep ecotype' Gene: MADE_02749: Probable monothiol glutaredoxin ydhD	Glaciecola sp. HTCC2999 Gene: GHTCC_010100007517: Probable monothiol glutaredoxin ydhD	* Colwellia psychrerythraea 34H Site: position = -216 score = 6.4683 sequence = AAACTTGAGTAAAATACTCAAGTAT Gene: CPS_3475: Probable monothiol glutaredoxin ydhD	* Alteromonadales bacterium TW-7 Site: position = -162 score = 5.66028 sequence = ATTGTTGAGTATTTTACTCAAGTTT Gene: ATW7_06868: Probable monothiol glutaredoxin ydhD	* Pseudoalteromonas haloplanktis TAC125 Site: position = -163 score = 5.31576 sequence = ATTGTTGAGTATTCTACTCAAGTTT Gene: PSHAa1216: Probable monothiol glutaredoxin ydhD	* Pseudoalteromonas tunicata D2 Site: position = -164 score = 4.99413 sequence = AATCCCGAGTATTTTACTCAAGTTT Gene: PTD2_10759: Probable monothiol glutaredoxin ydhD	Idiomarina baltica OS145	* Idiomarina loihiensis L2TR Site: position = -44 score = 5.02314 sequence = ATACCTGAGTGTTTTAATCAACCAT Gene: IL1804: Probable monothiol glutaredoxin ydhD	Probable monothiol glutaredoxin ydhD

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog IscR - Alteromonadales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --