Regulon of IscR in Glaciecola sp. HTCC2999

Properties
Regulator type:	Transcription factor
TF locus tag:	GHTCC_010100002924
Regulator family:	Rrf2
Regulation mode:	activator (repressor)
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Regulog:	IscR - Alteromonadales
Statistics of regulated genes:
- Genes	9
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 43 sites [see more]

Member of regulog collections

By taxonomy - Alteromonadales
By trascription factor - IscR
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Regulated operons
	Locus Tag	Name	Function
Position: -87 Score: 7 Sequence: ATACTTGACTAAATTAGTCGGTTAA Position: -62 Score: 7.3 Sequence: ATACTTGACTAATTTAGTCGGGTAA Locus tag: GHTCC_010100002924 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: GHTCC_010100002929 Name: iscS Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily Locus tag: GHTCC_010100002934 Name: iscU Funciton: Iron-sulfur cluster assembly scaffold protein IscU Locus tag: GHTCC_010100002939 Name: iscA Funciton: Iron binding protein IscA for iron-sulfur cluster assembly Locus tag: GHTCC_010100002944 Name: hscB Funciton: Chaperone protein HscB Locus tag: GHTCC_010100002949 Name: hscA Funciton: Chaperone protein HscA Locus tag: GHTCC_010100002954 Name: fdx Funciton: ferredoxin, 2Fe-2S type, ISC system
	GHTCC_010100002924	iscR	Iron-sulfur cluster regulator IscR
	GHTCC_010100002929	iscS	Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
	GHTCC_010100002934	iscU	Iron-sulfur cluster assembly scaffold protein IscU
	GHTCC_010100002939	iscA	Iron binding protein IscA for iron-sulfur cluster assembly
	GHTCC_010100002944	hscB	Chaperone protein HscB
	GHTCC_010100002949	hscA	Chaperone protein HscA
	GHTCC_010100002954	fdx	ferredoxin, 2Fe-2S type, ISC system
Position: -66 Score: 6.6 Sequence: ATACTTGATGAATTTACTCAAGTAT Locus tag: GHTCC_010100001060 Name: erpA Funciton: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
	GHTCC_010100001060	erpA	ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
Position: -72 Score: 6.7 Sequence: ATACTTGACTGTTTTAGTCGGGTAA Locus tag: GHTCC_010100008811 Name: nfuA Funciton: NfuA Fe-S protein maturation
	GHTCC_010100008811	nfuA	NfuA Fe-S protein maturation

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD