Regulon of IscR in Colwellia psychrerythraea 34H

Properties
Regulator type:	Transcription factor
TF locus tag:	CPS_1131
Regulator family:	Rrf2
Regulation mode:	activator (repressor)
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Regulog:	IscR - Alteromonadales
Statistics of regulated genes:
- Genes	11
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 43 sites [see more]

Member of regulog collections

By taxonomy - Alteromonadales
By trascription factor - IscR
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Regulated operons
	Locus Tag	Name	Function
Position: -216 Score: 6.5 Sequence: AAACTTGAGTAAAATACTCAAGTAT Locus tag: CPS_3475 Name: ydhD Funciton: Probable monothiol glutaredoxin ydhD
	CPS_3475	ydhD	Probable monothiol glutaredoxin ydhD
Position: -254 Score: 6.3 Sequence: ATAGTTGAGTAAAACAGTCAACTAT Position: -199 Score: 6.5 Sequence: ATACCTGAGTAAATCACTAGGGTAT Locus tag: CPS_1131 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: CPS_1132 Name: iscS Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily Locus tag: CPS_1133 Name: iscU Funciton: Iron-sulfur cluster assembly scaffold protein IscU Locus tag: CPS_1134 Name: iscA Funciton: Iron binding protein IscA for iron-sulfur cluster assembly Locus tag: CPS_1135 Name: hscB Funciton: Chaperone protein HscB Locus tag: CPS_1136 Name: hscA Funciton: Chaperone protein HscA Locus tag: CPS_1137 Name: fdx Funciton: ferredoxin, 2Fe-2S type, ISC system
	CPS_1131	iscR	Iron-sulfur cluster regulator IscR
	CPS_1132	iscS	Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
	CPS_1133	iscU	Iron-sulfur cluster assembly scaffold protein IscU
	CPS_1134	iscA	Iron binding protein IscA for iron-sulfur cluster assembly
	CPS_1135	hscB	Chaperone protein HscB
	CPS_1136	hscA	Chaperone protein HscA
	CPS_1137	fdx	ferredoxin, 2Fe-2S type, ISC system
Position: -101 Score: 6.9 Sequence: ATACTTGACTAAAATAGTCAAGTTT Locus tag: CPS_4622 Name: erpA Funciton: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
	CPS_4622	erpA	ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
Position: -94 Score: 7.1 Sequence: ATACTTGAGTAAAACAGTCAGGTAT Locus tag: CPS_0220 Name: nfuA Funciton: NfuA Fe-S protein maturation Locus tag: CPS_0221 Name: CPS_0221 Funciton: Conserved hypothetical protein
	CPS_0220	nfuA	NfuA Fe-S protein maturation
	CPS_0221	CPS_0221	Conserved hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD