Regulog IscR - Pasteurellales

Properties
Regulator type:	Transcription factor
Regulator family:	Rrf2
Regulation mode:	activator (repressor)
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Phylum:	Proteobacteria
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 22 sites [see more]

Member of regulog collections

By taxonomy - Pasteurellales
By trascription factor - IscR
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Statistics of regulated genes
Genome	Genes	Operons
Haemophilus influenzae Rd KW20	10	2
Aggregatibacter aphrophilus NJ8700	11	3
Pasteurella multocida subsp. multocida str. Pm70	10	3
Mannheimia succiniciproducens MBEL55E	12	3
Actinobacillus succinogenes 130Z	11	3
Haemophilus somnus 2336	10	3
Actinobacillus pleuropneumoniae serovar 7 str. AP76	11	2
Haemophilus ducreyi 35000HP	10	2
Haemophilus parasuis SH0165	3	1

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes										Function

CRON 1.
erpA	Haemophilus influenzae Rd KW20 Gene: HI1723: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	* Aggregatibacter aphrophilus NJ8700 Site: position = -67 score = 4.92277 sequence = ATTCTTGAATGCCTTAGAGGGTTAT Gene: NT05HA_0581: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	* Pasteurella multocida subsp. multocida str. Pm70 Site: position = -65 score = 6.24918 sequence = ATTCTTGAACGAATTAGTCGGTTAT Gene: PM0458: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	* Mannheimia succiniciproducens MBEL55E Site: position = -73 score = 5.72663 sequence = TTGGTTGAACGAATTAGTCGGTTAT Gene: MS1307: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	* Actinobacillus succinogenes 130Z Site: position = -73 score = 5.73569 sequence = ATCCTTGAACGAATCAGTCGGTTAT Gene: Asuc_1030: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	* Haemophilus somnus 2336 Site: position = -64 score = 5.3123 sequence = AATCTTGAATGGTTTGGTTGGTTAT Gene: HSM_1296: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	Actinobacillus pleuropneumoniae serovar 7 str. AP76 Gene: APP7_1469: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	Haemophilus ducreyi 35000HP Gene: HD0684: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	Haemophilus parasuis SH0165 Gene: HAPS_2065: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family	ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
yacL	Haemophilus influenzae Rd KW20 Gene: HI1724: Conserved hypothetical protein	Aggregatibacter aphrophilus NJ8700 Gene: NT05HA_0580: Conserved hypothetical protein	Pasteurella multocida subsp. multocida str. Pm70 Gene: PM0457: Conserved hypothetical protein	Mannheimia succiniciproducens MBEL55E Gene: MS1308: Conserved hypothetical protein	Actinobacillus succinogenes 130Z Gene: Asuc_1029: Conserved hypothetical protein	Haemophilus somnus 2336 Gene: HSM_1295: Conserved hypothetical protein	Actinobacillus pleuropneumoniae serovar 7 str. AP76 Gene: APP7_1023: Conserved hypothetical protein	Haemophilus ducreyi 35000HP Gene: HD1708: Conserved hypothetical protein	Haemophilus parasuis SH0165 Gene: HAPS_0370: Conserved hypothetical protein	Conserved hypothetical protein

CRON 2.
nfuA	* Haemophilus influenzae Rd KW20 Site: position = -38 score = 4.84189 sequence = ATTCCCGATACTTTCTCTCAAGTAT Gene: HI0433: NfuA Fe-S protein maturation	* Aggregatibacter aphrophilus NJ8700 Site: position = -43 score = 5.25689 sequence = ATGCCCGACAAAATCAATCAAGTTT Gene: NT05HA_1766: NfuA Fe-S protein maturation	* Pasteurella multocida subsp. multocida str. Pm70 Site: position = -46 score = 5.81507 sequence = ATTCTTGACAATCTTACTCAAGTAT Gene: PM1557: NfuA Fe-S protein maturation	* Mannheimia succiniciproducens MBEL55E Site: position = -59 score = 5.65582 sequence = ATTCCCGACTATGTTAGTCAGCTAT Gene: MS2232: NfuA Fe-S protein maturation	* Actinobacillus succinogenes 130Z Site: position = -40 score = 4.58466 sequence = ATTTCCGACCGTAAAACTCAGATAA Gene: Asuc_0296: NfuA Fe-S protein maturation	* Haemophilus somnus 2336 Site: position = -43 score = 5.96035 sequence = ATTCCTGATAATTTTACTCAAGTAT Gene: HSM_0510: NfuA Fe-S protein maturation	* Actinobacillus pleuropneumoniae serovar 7 str. AP76 Site: position = -49 score = 5.55584 sequence = ATATCCGATAAATTTAGTCAATTAA Gene: APP7_0151: NfuA Fe-S protein maturation	* Haemophilus ducreyi 35000HP Site: position = -47 score = 5.5942 sequence = ATGGCTGATAATTTTAGTCAAGTTA Gene: HD0378: NfuA Fe-S protein maturation	Haemophilus parasuis SH0165 Gene: HAPS_1078: NfuA Fe-S protein maturation	NfuA Fe-S protein maturation

CRON 3.
iscR	* Haemophilus influenzae Rd KW20 Site: position = -60 score = 6.30945 sequence = ATAATTGACTAAATTAGTCAGATAT Gene: HI0379: Iron-sulfur cluster regulator IscR	* Aggregatibacter aphrophilus NJ8700 Site: position = -68 score = 5.21099 sequence = ATAGTTGACTAAACAAGTCAACAAT Gene: NT05HA_1200: Iron-sulfur cluster regulator IscR	* Pasteurella multocida subsp. multocida str. Pm70 Site: position = -69 score = 5.9168 sequence = ATAGTTGACTAATTTAGTATGATAT Gene: PM0317: Iron-sulfur cluster regulator IscR	* Mannheimia succiniciproducens MBEL55E Site: position = -69 score = 6.16141 sequence = ATAGTTGACTAATTTACTTGGTTAT Gene: MS1727: Iron-sulfur cluster regulator IscR	* Actinobacillus succinogenes 130Z Site: position = -64 score = 5.95617 sequence = ATAGTTGATTAATTTGGTTGGTTAT Gene: Asuc_0863: Iron-sulfur cluster regulator IscR	* Haemophilus somnus 2336 Site: position = -65 score = 5.24966 sequence = GAAGTTGACTAATTTAGTAGGATTA Gene: HSM_0153: Iron-sulfur cluster regulator IscR	* Actinobacillus pleuropneumoniae serovar 7 str. AP76 Site: position = -83 score = 5.94631 sequence = ATTCTTGACTGTAACAGTCAGGTAT Gene: APP7_0990: Iron-sulfur cluster regulator IscR	* Haemophilus ducreyi 35000HP Site: position = -75 score = 6.17607 sequence = ATGCTTGACTAAAATAGTCGAGTAT Gene: HD1080: Iron-sulfur cluster regulator IscR	* Haemophilus parasuis SH0165 Site: position = -70 score = 5.99586 sequence = AATATTGACTAAATTAGTAGGGTAT Gene: HAPS_0052: Iron-sulfur cluster regulator IscR	Iron-sulfur cluster regulator IscR
iscS	Haemophilus influenzae Rd KW20 Gene: HI0378: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Aggregatibacter aphrophilus NJ8700 Gene: NT05HA_1201: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Pasteurella multocida subsp. multocida str. Pm70 Gene: PM0318: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Mannheimia succiniciproducens MBEL55E Gene: MS1726: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Actinobacillus succinogenes 130Z Gene: Asuc_0864: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Haemophilus somnus 2336 Gene: HSM_0154: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Actinobacillus pleuropneumoniae serovar 7 str. AP76 Gene: APP7_0989: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Haemophilus ducreyi 35000HP Gene: HD1082: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Haemophilus parasuis SH0165 Gene: HAPS_0053: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily	Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
iscU	Haemophilus influenzae Rd KW20 Gene: HI0377: Iron-sulfur cluster assembly scaffold protein IscU	Aggregatibacter aphrophilus NJ8700 Gene: NT05HA_1202: Iron-sulfur cluster assembly scaffold protein IscU	Pasteurella multocida subsp. multocida str. Pm70 Gene: PM0319: Iron-sulfur cluster assembly scaffold protein IscU	Mannheimia succiniciproducens MBEL55E Gene: MS1724: Iron-sulfur cluster assembly scaffold protein IscU	Actinobacillus succinogenes 130Z Gene: Asuc_0865: Iron-sulfur cluster assembly scaffold protein IscU	Haemophilus somnus 2336 Gene: HSM_0155: Iron-sulfur cluster assembly scaffold protein IscU	Actinobacillus pleuropneumoniae serovar 7 str. AP76 Gene: APP7_0988: Iron-sulfur cluster assembly scaffold protein IscU	Haemophilus ducreyi 35000HP Gene: HD1083: Iron-sulfur cluster assembly scaffold protein IscU	Haemophilus parasuis SH0165 Gene: HAPS_0054: Iron-sulfur cluster assembly scaffold protein IscU	Iron-sulfur cluster assembly scaffold protein IscU
iscA	Haemophilus influenzae Rd KW20 Gene: HI0376: Iron binding protein IscA for iron-sulfur cluster assembly	Aggregatibacter aphrophilus NJ8700 Gene: NT05HA_1203: Iron binding protein IscA for iron-sulfur cluster assembly	Pasteurella multocida subsp. multocida str. Pm70 Gene: PM0320: Iron binding protein IscA for iron-sulfur cluster assembly	Mannheimia succiniciproducens MBEL55E Gene: MS1723: Iron binding protein IscA for iron-sulfur cluster assembly	Actinobacillus succinogenes 130Z Gene: Asuc_0866: Iron binding protein IscA for iron-sulfur cluster assembly	Haemophilus somnus 2336 Gene: HSM_0156: Iron binding protein IscA for iron-sulfur cluster assembly	Actinobacillus pleuropneumoniae serovar 7 str. AP76 Gene: APP7_0987: Iron binding protein IscA for iron-sulfur cluster assembly	Haemophilus ducreyi 35000HP Gene: HD1084: Iron binding protein IscA for iron-sulfur cluster assembly	Haemophilus parasuis SH0165 Gene: HAPS_0055: Iron binding protein IscA for iron-sulfur cluster assembly	Iron binding protein IscA for iron-sulfur cluster assembly
hscB	Haemophilus influenzae Rd KW20 Gene: HI0375: Chaperone protein HscB	Aggregatibacter aphrophilus NJ8700 Gene: NT05HA_1204: Chaperone protein HscB	Pasteurella multocida subsp. multocida str. Pm70 Gene: PM0321: Chaperone protein HscB	Mannheimia succiniciproducens MBEL55E Gene: MS1722: Chaperone protein HscB	Actinobacillus succinogenes 130Z Gene: Asuc_0867: Chaperone protein HscB	Haemophilus somnus 2336 Gene: HSM_0157: Chaperone protein HscB	Actinobacillus pleuropneumoniae serovar 7 str. AP76 Gene: APP7_0986: Chaperone protein HscB	Haemophilus ducreyi 35000HP Gene: HD1085: Chaperone protein HscB	Haemophilus parasuis SH0165 Gene: HAPS_0056: Chaperone protein HscB	Chaperone protein HscB
NT05HA_2059	Haemophilus influenzae Rd KW20	Aggregatibacter aphrophilus NJ8700	Pasteurella multocida subsp. multocida str. Pm70	Mannheimia succiniciproducens MBEL55E	Actinobacillus succinogenes 130Z	Haemophilus somnus 2336	Actinobacillus pleuropneumoniae serovar 7 str. AP76 Gene: APP7_0985: Conserved hypothetical protein	Haemophilus ducreyi 35000HP	Haemophilus parasuis SH0165	Conserved hypothetical protein
DUF2625	Haemophilus influenzae Rd KW20 Gene: HI0374: conserved hypothetical protein, DUF2625	Aggregatibacter aphrophilus NJ8700	Pasteurella multocida subsp. multocida str. Pm70	Mannheimia succiniciproducens MBEL55E	Actinobacillus succinogenes 130Z	Haemophilus somnus 2336	Actinobacillus pleuropneumoniae serovar 7 str. AP76 Gene: APP7_0984: conserved hypothetical protein, DUF2625	Haemophilus ducreyi 35000HP Gene: HD1086: conserved hypothetical protein, DUF2625	Haemophilus parasuis SH0165 Gene: HAPS_0058: conserved hypothetical protein, DUF2625	conserved hypothetical protein, DUF2625
hscA	Haemophilus influenzae Rd KW20 Gene: HI0373: Chaperone protein HscA	Aggregatibacter aphrophilus NJ8700 Gene: NT05HA_1205: Chaperone protein HscA	Pasteurella multocida subsp. multocida str. Pm70 Gene: PM0322: Chaperone protein HscA	Mannheimia succiniciproducens MBEL55E Gene: MS1721: Chaperone protein HscA	Actinobacillus succinogenes 130Z Gene: Asuc_0868: Chaperone protein HscA	Haemophilus somnus 2336 Gene: HSM_0158: Chaperone protein HscA	Actinobacillus pleuropneumoniae serovar 7 str. AP76 Gene: APP7_0983: Chaperone protein HscA	Haemophilus ducreyi 35000HP Gene: HD1087: Chaperone protein HscA	Haemophilus parasuis SH0165 Gene: HAPS_0059: Chaperone protein HscA	Chaperone protein HscA
fdx	Haemophilus influenzae Rd KW20 Gene: HI0372: ferredoxin, 2Fe-2S type, ISC system	Aggregatibacter aphrophilus NJ8700 Gene: NT05HA_1206: ferredoxin, 2Fe-2S type, ISC system	Pasteurella multocida subsp. multocida str. Pm70 Gene: PM0323: ferredoxin, 2Fe-2S type, ISC system	Mannheimia succiniciproducens MBEL55E Gene: MS1720: ferredoxin, 2Fe-2S type, ISC system	Actinobacillus succinogenes 130Z Gene: Asuc_0869: ferredoxin, 2Fe-2S type, ISC system	Haemophilus somnus 2336 Gene: HSM_0159: ferredoxin, 2Fe-2S type, ISC system	Actinobacillus pleuropneumoniae serovar 7 str. AP76 Gene: APP7_0982: ferredoxin, 2Fe-2S type, ISC system	Haemophilus ducreyi 35000HP Gene: HD1088: ferredoxin, 2Fe-2S type, ISC system	Haemophilus parasuis SH0165 Gene: HAPS_0060: ferredoxin, 2Fe-2S type, ISC system	ferredoxin, 2Fe-2S type, ISC system
yfhJ	Haemophilus influenzae Rd KW20 Gene: HI0371: putative Fe-S cluster assembly protein	Aggregatibacter aphrophilus NJ8700 Gene: NT05HA_1207: putative Fe-S cluster assembly protein	Pasteurella multocida subsp. multocida str. Pm70	Mannheimia succiniciproducens MBEL55E Gene: MS1719: putative Fe-S cluster assembly protein	Actinobacillus succinogenes 130Z Gene: Asuc_0870: putative Fe-S cluster assembly protein	Haemophilus somnus 2336	Actinobacillus pleuropneumoniae serovar 7 str. AP76 Gene: APP7_0981: putative Fe-S cluster assembly protein	Haemophilus ducreyi 35000HP Gene: HD1089: putative Fe-S cluster assembly protein	Haemophilus parasuis SH0165 Gene: HAPS_0061: putative Fe-S cluster assembly protein	putative Fe-S cluster assembly protein
MS1725	Haemophilus influenzae Rd KW20	Aggregatibacter aphrophilus NJ8700	Pasteurella multocida subsp. multocida str. Pm70	Mannheimia succiniciproducens MBEL55E Gene: MS1725: Hypothetical protein	Actinobacillus succinogenes 130Z	Haemophilus somnus 2336	Actinobacillus pleuropneumoniae serovar 7 str. AP76	Haemophilus ducreyi 35000HP	Haemophilus parasuis SH0165	Hypothetical protein

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog IscR - Pasteurellales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --