Regulog IscR - Pasteurellales
| Regulator type: | Transcription factor |
| Regulator family: | Rrf2 |
| Regulation mode: | activator (repressor) |
| Biological process: | Iron-sulfur cluster biogenesis |
| Effector: | Iron-sulfur cluster redox state |
| Phylum: | Proteobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Pasteurellales
- By trascription factor - IscR
- By TF family - Rrf2
- By effector - Iron-sulfur cluster redox state
- By pathway - Iron-sulfur cluster biogenesis
| Genome | Genes | Operons |
|---|---|---|
| Haemophilus influenzae Rd KW20 | 10 | 2 |
| Aggregatibacter aphrophilus NJ8700 | 11 | 3 |
| Pasteurella multocida subsp. multocida str. Pm70 | 10 | 3 |
| Mannheimia succiniciproducens MBEL55E | 12 | 3 |
| Actinobacillus succinogenes 130Z | 11 | 3 |
| Haemophilus somnus 2336 | 10 | 3 |
| Actinobacillus pleuropneumoniae serovar 7 str. AP76 | 11 | 2 |
| Haemophilus ducreyi 35000HP | 10 | 2 |
| Haemophilus parasuis SH0165 | 3 | 1 |
| Genes | Function | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||
| erpA |
Gene: HI1723: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family |
*
Aggregatibacter aphrophilus NJ8700 Site: position = -67 score = 4.92277 sequence = ATTCTTGAATGCCTTAGAGGGTTAT Gene: NT05HA_0581: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family |
*
Pasteurella multocida subsp. multocida str. Pm70 Site: position = -65 score = 6.24918 sequence = ATTCTTGAACGAATTAGTCGGTTAT Gene: PM0458: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family |
*
Mannheimia succiniciproducens MBEL55E Site: position = -73 score = 5.72663 sequence = TTGGTTGAACGAATTAGTCGGTTAT Gene: MS1307: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family |
*
Actinobacillus succinogenes 130Z Site: position = -73 score = 5.73569 sequence = ATCCTTGAACGAATCAGTCGGTTAT Gene: Asuc_1030: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family |
*
Haemophilus somnus 2336 Site: position = -64 score = 5.3123 sequence = AATCTTGAATGGTTTGGTTGGTTAT Gene: HSM_1296: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family |
Gene: APP7_1469: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family |
Gene: HD0684: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family |
Gene: HAPS_2065: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family |
ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family |
| yacL |
Gene: HI1724: Conserved hypothetical protein |
Gene: NT05HA_0580: Conserved hypothetical protein |
Gene: PM0457: Conserved hypothetical protein |
Gene: MS1308: Conserved hypothetical protein |
Gene: Asuc_1029: Conserved hypothetical protein |
Gene: HSM_1295: Conserved hypothetical protein |
Gene: APP7_1023: Conserved hypothetical protein |
Gene: HD1708: Conserved hypothetical protein |
Gene: HAPS_0370: Conserved hypothetical protein |
Conserved hypothetical protein |
| CRON 2. | ||||||||||
| nfuA |
*
Haemophilus influenzae Rd KW20 Site: position = -38 score = 4.84189 sequence = ATTCCCGATACTTTCTCTCAAGTAT Gene: HI0433: NfuA Fe-S protein maturation |
*
Aggregatibacter aphrophilus NJ8700 Site: position = -43 score = 5.25689 sequence = ATGCCCGACAAAATCAATCAAGTTT Gene: NT05HA_1766: NfuA Fe-S protein maturation |
*
Pasteurella multocida subsp. multocida str. Pm70 Site: position = -46 score = 5.81507 sequence = ATTCTTGACAATCTTACTCAAGTAT Gene: PM1557: NfuA Fe-S protein maturation |
*
Mannheimia succiniciproducens MBEL55E Site: position = -59 score = 5.65582 sequence = ATTCCCGACTATGTTAGTCAGCTAT Gene: MS2232: NfuA Fe-S protein maturation |
*
Actinobacillus succinogenes 130Z Site: position = -40 score = 4.58466 sequence = ATTTCCGACCGTAAAACTCAGATAA Gene: Asuc_0296: NfuA Fe-S protein maturation |
*
Haemophilus somnus 2336 Site: position = -43 score = 5.96035 sequence = ATTCCTGATAATTTTACTCAAGTAT Gene: HSM_0510: NfuA Fe-S protein maturation |
*
Actinobacillus pleuropneumoniae serovar 7 str. AP76 Site: position = -49 score = 5.55584 sequence = ATATCCGATAAATTTAGTCAATTAA Gene: APP7_0151: NfuA Fe-S protein maturation |
*
Haemophilus ducreyi 35000HP Site: position = -47 score = 5.5942 sequence = ATGGCTGATAATTTTAGTCAAGTTA Gene: HD0378: NfuA Fe-S protein maturation |
Gene: HAPS_1078: NfuA Fe-S protein maturation |
NfuA Fe-S protein maturation |
| CRON 3. | ||||||||||
| iscR |
*
Haemophilus influenzae Rd KW20 Site: position = -60 score = 6.30945 sequence = ATAATTGACTAAATTAGTCAGATAT Gene: HI0379: Iron-sulfur cluster regulator IscR |
*
Aggregatibacter aphrophilus NJ8700 Site: position = -68 score = 5.21099 sequence = ATAGTTGACTAAACAAGTCAACAAT Gene: NT05HA_1200: Iron-sulfur cluster regulator IscR |
*
Pasteurella multocida subsp. multocida str. Pm70 Site: position = -69 score = 5.9168 sequence = ATAGTTGACTAATTTAGTATGATAT Gene: PM0317: Iron-sulfur cluster regulator IscR |
*
Mannheimia succiniciproducens MBEL55E Site: position = -69 score = 6.16141 sequence = ATAGTTGACTAATTTACTTGGTTAT Gene: MS1727: Iron-sulfur cluster regulator IscR |
*
Actinobacillus succinogenes 130Z Site: position = -64 score = 5.95617 sequence = ATAGTTGATTAATTTGGTTGGTTAT Gene: Asuc_0863: Iron-sulfur cluster regulator IscR |
*
Haemophilus somnus 2336 Site: position = -65 score = 5.24966 sequence = GAAGTTGACTAATTTAGTAGGATTA Gene: HSM_0153: Iron-sulfur cluster regulator IscR |
*
Actinobacillus pleuropneumoniae serovar 7 str. AP76 Site: position = -83 score = 5.94631 sequence = ATTCTTGACTGTAACAGTCAGGTAT Gene: APP7_0990: Iron-sulfur cluster regulator IscR |
*
Haemophilus ducreyi 35000HP Site: position = -75 score = 6.17607 sequence = ATGCTTGACTAAAATAGTCGAGTAT Gene: HD1080: Iron-sulfur cluster regulator IscR |
*
Haemophilus parasuis SH0165 Site: position = -70 score = 5.99586 sequence = AATATTGACTAAATTAGTAGGGTAT Gene: HAPS_0052: Iron-sulfur cluster regulator IscR |
Iron-sulfur cluster regulator IscR |
| iscS |
Gene: HI0378: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: NT05HA_1201: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: PM0318: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: MS1726: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: Asuc_0864: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: HSM_0154: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: APP7_0989: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: HD1082: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: HAPS_0053: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
| iscU |
Gene: HI0377: Iron-sulfur cluster assembly scaffold protein IscU |
Gene: NT05HA_1202: Iron-sulfur cluster assembly scaffold protein IscU |
Gene: PM0319: Iron-sulfur cluster assembly scaffold protein IscU |
Gene: MS1724: Iron-sulfur cluster assembly scaffold protein IscU |
Gene: Asuc_0865: Iron-sulfur cluster assembly scaffold protein IscU |
Gene: HSM_0155: Iron-sulfur cluster assembly scaffold protein IscU |
Gene: APP7_0988: Iron-sulfur cluster assembly scaffold protein IscU |
Gene: HD1083: Iron-sulfur cluster assembly scaffold protein IscU |
Gene: HAPS_0054: Iron-sulfur cluster assembly scaffold protein IscU |
Iron-sulfur cluster assembly scaffold protein IscU |
| iscA |
Gene: HI0376: Iron binding protein IscA for iron-sulfur cluster assembly |
Gene: NT05HA_1203: Iron binding protein IscA for iron-sulfur cluster assembly |
Gene: PM0320: Iron binding protein IscA for iron-sulfur cluster assembly |
Gene: MS1723: Iron binding protein IscA for iron-sulfur cluster assembly |
Gene: Asuc_0866: Iron binding protein IscA for iron-sulfur cluster assembly |
Gene: HSM_0156: Iron binding protein IscA for iron-sulfur cluster assembly |
Gene: APP7_0987: Iron binding protein IscA for iron-sulfur cluster assembly |
Gene: HD1084: Iron binding protein IscA for iron-sulfur cluster assembly |
Gene: HAPS_0055: Iron binding protein IscA for iron-sulfur cluster assembly |
Iron binding protein IscA for iron-sulfur cluster assembly |
| hscB |
Gene: HI0375: Chaperone protein HscB |
Gene: NT05HA_1204: Chaperone protein HscB |
Gene: PM0321: Chaperone protein HscB |
Gene: MS1722: Chaperone protein HscB |
Gene: Asuc_0867: Chaperone protein HscB |
Gene: HSM_0157: Chaperone protein HscB |
Gene: APP7_0986: Chaperone protein HscB |
Gene: HD1085: Chaperone protein HscB |
Gene: HAPS_0056: Chaperone protein HscB |
Chaperone protein HscB |
| NT05HA_2059 |
|
|
|
|
|
|
Gene: APP7_0985: Conserved hypothetical protein |
|
|
Conserved hypothetical protein |
| DUF2625 |
Gene: HI0374: conserved hypothetical protein, DUF2625 |
|
|
|
|
|
Gene: APP7_0984: conserved hypothetical protein, DUF2625 |
Gene: HD1086: conserved hypothetical protein, DUF2625 |
Gene: HAPS_0058: conserved hypothetical protein, DUF2625 |
conserved hypothetical protein, DUF2625 |
| hscA |
Gene: HI0373: Chaperone protein HscA |
Gene: NT05HA_1205: Chaperone protein HscA |
Gene: PM0322: Chaperone protein HscA |
Gene: MS1721: Chaperone protein HscA |
Gene: Asuc_0868: Chaperone protein HscA |
Gene: HSM_0158: Chaperone protein HscA |
Gene: APP7_0983: Chaperone protein HscA |
Gene: HD1087: Chaperone protein HscA |
Gene: HAPS_0059: Chaperone protein HscA |
Chaperone protein HscA |
| fdx |
Gene: HI0372: ferredoxin, 2Fe-2S type, ISC system |
Gene: NT05HA_1206: ferredoxin, 2Fe-2S type, ISC system |
Gene: PM0323: ferredoxin, 2Fe-2S type, ISC system |
Gene: MS1720: ferredoxin, 2Fe-2S type, ISC system |
Gene: Asuc_0869: ferredoxin, 2Fe-2S type, ISC system |
Gene: HSM_0159: ferredoxin, 2Fe-2S type, ISC system |
Gene: APP7_0982: ferredoxin, 2Fe-2S type, ISC system |
Gene: HD1088: ferredoxin, 2Fe-2S type, ISC system |
Gene: HAPS_0060: ferredoxin, 2Fe-2S type, ISC system |
ferredoxin, 2Fe-2S type, ISC system |
| yfhJ |
Gene: HI0371: putative Fe-S cluster assembly protein |
Gene: NT05HA_1207: putative Fe-S cluster assembly protein |
|
Gene: MS1719: putative Fe-S cluster assembly protein |
Gene: Asuc_0870: putative Fe-S cluster assembly protein |
|
Gene: APP7_0981: putative Fe-S cluster assembly protein |
Gene: HD1089: putative Fe-S cluster assembly protein |
Gene: HAPS_0061: putative Fe-S cluster assembly protein |
putative Fe-S cluster assembly protein |
| MS1725 |
|
|
|
Gene: MS1725: Hypothetical protein |
|
|
|
|
|
Hypothetical protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |