Regulon of IscR in Pasteurella multocida subsp. multocida str. Pm70

Properties
Regulator type:	Transcription factor
TF locus tag:	PM0317
Regulator family:	Rrf2
Regulation mode:	activator (repressor)
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Regulog:	IscR - Pasteurellales
Statistics of regulated genes:
- Genes	10
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 22 sites [see more]

Member of regulog collections

By taxonomy - Pasteurellales
By trascription factor - IscR
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Regulated operons
	Locus Tag	Name	Function
Position: -46 Score: 5.8 Sequence: ATTCTTGACAATCTTACTCAAGTAT Locus tag: PM1557 Name: nfuA Funciton: NfuA Fe-S protein maturation
	PM1557	nfuA	NfuA Fe-S protein maturation
Position: -69 Score: 5.9 Sequence: ATAGTTGACTAATTTAGTATGATAT Locus tag: PM0317 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: PM0318 Name: iscS Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily Locus tag: PM0319 Name: iscU Funciton: Iron-sulfur cluster assembly scaffold protein IscU Locus tag: PM0320 Name: iscA Funciton: Iron binding protein IscA for iron-sulfur cluster assembly Locus tag: PM0321 Name: hscB Funciton: Chaperone protein HscB Locus tag: PM0322 Name: hscA Funciton: Chaperone protein HscA Locus tag: PM0323 Name: fdx Funciton: ferredoxin, 2Fe-2S type, ISC system
	PM0317	iscR	Iron-sulfur cluster regulator IscR
	PM0318	iscS	Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
	PM0319	iscU	Iron-sulfur cluster assembly scaffold protein IscU
	PM0320	iscA	Iron binding protein IscA for iron-sulfur cluster assembly
	PM0321	hscB	Chaperone protein HscB
	PM0322	hscA	Chaperone protein HscA
	PM0323	fdx	ferredoxin, 2Fe-2S type, ISC system
Position: -65 Score: 6.2 Sequence: ATTCTTGAACGAATTAGTCGGTTAT Locus tag: PM0458 Name: erpA Funciton: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family Locus tag: PM0457 Name: yacL Funciton: Conserved hypothetical protein
	PM0458	erpA	ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
	PM0457	yacL	Conserved hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD