Regulon of IscR in Actinobacillus succinogenes 130Z

Properties
Regulator type:	Transcription factor
TF locus tag:	Asuc_0863
Regulator family:	Rrf2
Regulation mode:	activator (repressor)
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Regulog:	IscR - Pasteurellales
Statistics of regulated genes:
- Genes	11
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 22 sites [see more]

Member of regulog collections

By taxonomy - Pasteurellales
By trascription factor - IscR
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Regulated operons
	Locus Tag	Name	Function
Position: -40 Score: 4.6 Sequence: ATTTCCGACCGTAAAACTCAGATAA Locus tag: Asuc_0296 Name: nfuA Funciton: NfuA Fe-S protein maturation
	Asuc_0296	nfuA	NfuA Fe-S protein maturation
Position: -64 Score: 6 Sequence: ATAGTTGATTAATTTGGTTGGTTAT Locus tag: Asuc_0863 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: Asuc_0864 Name: iscS Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily Locus tag: Asuc_0865 Name: iscU Funciton: Iron-sulfur cluster assembly scaffold protein IscU Locus tag: Asuc_0866 Name: iscA Funciton: Iron binding protein IscA for iron-sulfur cluster assembly Locus tag: Asuc_0867 Name: hscB Funciton: Chaperone protein HscB Locus tag: Asuc_0868 Name: hscA Funciton: Chaperone protein HscA Locus tag: Asuc_0869 Name: fdx Funciton: ferredoxin, 2Fe-2S type, ISC system Locus tag: Asuc_0870 Name: yfhJ Funciton: putative Fe-S cluster assembly protein
	Asuc_0863	iscR	Iron-sulfur cluster regulator IscR
	Asuc_0864	iscS	Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
	Asuc_0865	iscU	Iron-sulfur cluster assembly scaffold protein IscU
	Asuc_0866	iscA	Iron binding protein IscA for iron-sulfur cluster assembly
	Asuc_0867	hscB	Chaperone protein HscB
	Asuc_0868	hscA	Chaperone protein HscA
	Asuc_0869	fdx	ferredoxin, 2Fe-2S type, ISC system
	Asuc_0870	yfhJ	putative Fe-S cluster assembly protein
Position: -73 Score: 5.7 Sequence: ATCCTTGAACGAATCAGTCGGTTAT Locus tag: Asuc_1030 Name: erpA Funciton: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family Locus tag: Asuc_1029 Name: yacL Funciton: Conserved hypothetical protein
	Asuc_1030	erpA	ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
	Asuc_1029	yacL	Conserved hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD