Orthologous regulated operons containing DUF2625 gene

Properties
Regulog:	IscR - Pasteurellales
Regulator type:	Transcription factor
Regulator family:	Rrf2
Regulation mode:	activator (repressor)
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Phylum:	Proteobacteria

Built upon 22 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Actinobacillus pleuropneumoniae serovar 7 str. AP76
Position: -83 Score: 5.94631 Sequence: ATTCTTGACTGTAACAGTCAGGTAT Locus tag: APP7_0990 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: APP7_0989 Name: iscS Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily Locus tag: APP7_0988 Name: iscU Funciton: Iron-sulfur cluster assembly scaffold protein IscU Locus tag: APP7_0987 Name: iscA Funciton: Iron binding protein IscA for iron-sulfur cluster assembly Locus tag: APP7_0986 Name: hscB Funciton: Chaperone protein HscB Locus tag: APP7_0985 Name: NT05HA_2059 Funciton: Conserved hypothetical protein Locus tag: APP7_0984 Name: DUF2625 Funciton: conserved hypothetical protein, DUF2625 Locus tag: APP7_0983 Name: hscA Funciton: Chaperone protein HscA Locus tag: APP7_0982 Name: fdx Funciton: ferredoxin, 2Fe-2S type, ISC system Locus tag: APP7_0981 Name: yfhJ Funciton: putative Fe-S cluster assembly protein
iscR-iscS-iscU-iscA-hscB-NT05HA_2059-DUF2625-hscA-fdx-yfhJ	-83	5.9	ATTCTTGACTGTAACAGTCAGGTAT	APP7_0990
Haemophilus ducreyi 35000HP
Position: -75 Score: 6.17607 Sequence: ATGCTTGACTAAAATAGTCGAGTAT Locus tag: HD1080 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: HD1082 Name: iscS Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily Locus tag: HD1083 Name: iscU Funciton: Iron-sulfur cluster assembly scaffold protein IscU Locus tag: HD1084 Name: iscA Funciton: Iron binding protein IscA for iron-sulfur cluster assembly Locus tag: HD1085 Name: hscB Funciton: Chaperone protein HscB Locus tag: HD1086 Name: DUF2625 Funciton: conserved hypothetical protein, DUF2625 Locus tag: HD1087 Name: hscA Funciton: Chaperone protein HscA Locus tag: HD1088 Name: fdx Funciton: ferredoxin, 2Fe-2S type, ISC system Locus tag: HD1089 Name: yfhJ Funciton: putative Fe-S cluster assembly protein
iscR-iscS-iscU-iscA-hscB-DUF2625-hscA-fdx-yfhJ	-75	6.2	ATGCTTGACTAAAATAGTCGAGTAT	HD1080
Haemophilus influenzae Rd KW20
Position: -60 Score: 6.30945 Sequence: ATAATTGACTAAATTAGTCAGATAT Locus tag: HI0379 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: HI0378 Name: iscS Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily Locus tag: HI0377 Name: iscU Funciton: Iron-sulfur cluster assembly scaffold protein IscU Locus tag: HI0376 Name: iscA Funciton: Iron binding protein IscA for iron-sulfur cluster assembly Locus tag: HI0375 Name: hscB Funciton: Chaperone protein HscB Locus tag: HI0374 Name: DUF2625 Funciton: conserved hypothetical protein, DUF2625 Locus tag: HI0373 Name: hscA Funciton: Chaperone protein HscA Locus tag: HI0372 Name: fdx Funciton: ferredoxin, 2Fe-2S type, ISC system Locus tag: HI0371 Name: yfhJ Funciton: putative Fe-S cluster assembly protein
iscR-iscS-iscU-iscA-hscB-DUF2625-hscA-fdx-yfhJ	-60	6.3	ATAATTGACTAAATTAGTCAGATAT	HI0379