Regulon of IscR in Haemophilus parasuis SH0165

Properties
Regulator type:	Transcription factor
TF locus tag:	HAPS_0052
Regulator family:	Rrf2
Regulation mode:	activator (repressor)
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Regulog:	IscR - Pasteurellales
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 22 sites [see more]

Member of regulog collections

By taxonomy - Pasteurellales
By trascription factor - IscR
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Regulated operons
	Locus Tag	Name	Function
Position: -70 Score: 6 Sequence: AATATTGACTAAATTAGTAGGGTAT Locus tag: HAPS_0052 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: HAPS_0053 Name: iscS Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily Locus tag: HAPS_0054 Name: iscU Funciton: Iron-sulfur cluster assembly scaffold protein IscU
	HAPS_0052	iscR	Iron-sulfur cluster regulator IscR
	HAPS_0053	iscS	Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
	HAPS_0054	iscU	Iron-sulfur cluster assembly scaffold protein IscU

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD