Regulon of IscR in Mannheimia succiniciproducens MBEL55E

Properties
Regulator type:	Transcription factor
TF locus tag:	MS1727
Regulator family:	Rrf2
Regulation mode:	activator (repressor)
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Regulog:	IscR - Pasteurellales
Statistics of regulated genes:
- Genes	12
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 22 sites [see more]

Member of regulog collections

By taxonomy - Pasteurellales
By trascription factor - IscR
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Regulated operons
	Locus Tag	Name	Function
Position: -59 Score: 5.7 Sequence: ATTCCCGACTATGTTAGTCAGCTAT Locus tag: MS2232 Name: nfuA Funciton: NfuA Fe-S protein maturation
	MS2232	nfuA	NfuA Fe-S protein maturation
Position: -69 Score: 6.2 Sequence: ATAGTTGACTAATTTACTTGGTTAT Locus tag: MS1727 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: MS1726 Name: iscS Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily Locus tag: MS1725 Name: MS1725 Funciton: Hypothetical protein Locus tag: MS1724 Name: iscU Funciton: Iron-sulfur cluster assembly scaffold protein IscU Locus tag: MS1723 Name: iscA Funciton: Iron binding protein IscA for iron-sulfur cluster assembly Locus tag: MS1722 Name: hscB Funciton: Chaperone protein HscB Locus tag: MS1721 Name: hscA Funciton: Chaperone protein HscA Locus tag: MS1720 Name: fdx Funciton: ferredoxin, 2Fe-2S type, ISC system Locus tag: MS1719 Name: yfhJ Funciton: putative Fe-S cluster assembly protein
	MS1727	iscR	Iron-sulfur cluster regulator IscR
	MS1726	iscS	Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
	MS1725	MS1725	Hypothetical protein
	MS1724	iscU	Iron-sulfur cluster assembly scaffold protein IscU
	MS1723	iscA	Iron binding protein IscA for iron-sulfur cluster assembly
	MS1722	hscB	Chaperone protein HscB
	MS1721	hscA	Chaperone protein HscA
	MS1720	fdx	ferredoxin, 2Fe-2S type, ISC system
	MS1719	yfhJ	putative Fe-S cluster assembly protein
Position: -73 Score: 5.7 Sequence: TTGGTTGAACGAATTAGTCGGTTAT Locus tag: MS1307 Name: erpA Funciton: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family Locus tag: MS1308 Name: yacL Funciton: Conserved hypothetical protein
	MS1307	erpA	ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
	MS1308	yacL	Conserved hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD