Regulon of IscR in Haemophilus influenzae Rd KW20

Properties
Regulator type:	Transcription factor
TF locus tag:	HI0379
Regulator family:	Rrf2
Regulation mode:	activator (repressor)
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Regulog:	IscR - Pasteurellales
Statistics of regulated genes:
- Genes	10
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 22 sites [see more]

Member of regulog collections

By taxonomy - Pasteurellales
By trascription factor - IscR
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Regulated operons
	Locus Tag	Name	Function
Position: -38 Score: 4.8 Sequence: ATTCCCGATACTTTCTCTCAAGTAT Locus tag: HI0433 Name: nfuA Funciton: NfuA Fe-S protein maturation
	HI0433	nfuA	NfuA Fe-S protein maturation
Position: -60 Score: 6.3 Sequence: ATAATTGACTAAATTAGTCAGATAT Locus tag: HI0379 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: HI0378 Name: iscS Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily Locus tag: HI0377 Name: iscU Funciton: Iron-sulfur cluster assembly scaffold protein IscU Locus tag: HI0376 Name: iscA Funciton: Iron binding protein IscA for iron-sulfur cluster assembly Locus tag: HI0375 Name: hscB Funciton: Chaperone protein HscB Locus tag: HI0374 Name: DUF2625 Funciton: conserved hypothetical protein, DUF2625 Locus tag: HI0373 Name: hscA Funciton: Chaperone protein HscA Locus tag: HI0372 Name: fdx Funciton: ferredoxin, 2Fe-2S type, ISC system Locus tag: HI0371 Name: yfhJ Funciton: putative Fe-S cluster assembly protein
	HI0379	iscR	Iron-sulfur cluster regulator IscR
	HI0378	iscS	Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
	HI0377	iscU	Iron-sulfur cluster assembly scaffold protein IscU
	HI0376	iscA	Iron binding protein IscA for iron-sulfur cluster assembly
	HI0375	hscB	Chaperone protein HscB
	HI0374	DUF2625	conserved hypothetical protein, DUF2625
	HI0373	hscA	Chaperone protein HscA
	HI0372	fdx	ferredoxin, 2Fe-2S type, ISC system
	HI0371	yfhJ	putative Fe-S cluster assembly protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD