Regulog MntR - Enterobacteriales

Properties
Regulator type:	Transcription factor
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Manganese homeostasis
Effector:	Manganese ion, (Mn2+)
Phylum:	Proteobacteria/gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 35 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By trascription factor - MntR
By TF family - DtxR
By effector - Manganese ion, (Mn2+)
By pathway - Manganese homeostasis

Statistics of regulated genes
Genome	Genes	Operons
Escherichia coli str. K-12 substr. MG1655	5	4
Salmonella typhimurium LT2	8	4
Citrobacter koseri ATCC BAA-895	12	5
Klebsiella pneumoniae subsp. pneumoniae MGH 78578	8	4
Enterobacter sp. 638	8	4
Erwinia amylovora ATCC 49946	7	4
Yersinia pestis KIM
Serratia proteamaculans 568	2	2
Erwinia carotovora subsp. atroseptica SCRI1043
Edwardsiella tarda EIB202
Proteus mirabilis HI4320
Photorhabdus luminescens subsp. laumondii TTO1

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes													Function

CRON 1.
mntH	* Escherichia coli str. K-12 substr. MG1655 Site: position = -34 score = 6.86993 sequence = AAACATAGCAAAGGCTATGTTT Gene: b2392: Manganese transporter, NRAMP family	* Salmonella typhimurium LT2 Site: position = -34 score = 6.86993 sequence = AAACATAGCAAAGGCTATGTTT Gene: STM2408: Manganese transporter, NRAMP family	* Citrobacter koseri ATCC BAA-895 Site: position = -16 score = 6.86993 sequence = AAACATAGCAAAGGCTATGTTT Gene: CKO_00404: Manganese transporter, NRAMP family	* Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -35 score = 7.07119 sequence = AAACATAGCAAAGGCTATATTT Gene: KPN_02743: Manganese transporter, NRAMP family	* Enterobacter sp. 638 Site: position = -34 score = 6.78768 sequence = AAACATAGCAAAGGCTATATCT Gene: Ent638_2926: Manganese transporter, NRAMP family	* Erwinia amylovora ATCC 49946 Site: position = -133 score = 6.39868 sequence = AAGTATAGCAATTGCTATATTT Gene: EAM_2378: Manganese transporter, NRAMP family	Yersinia pestis KIM Gene: y1500: Manganese transporter, NRAMP family	2 Serratia proteamaculans 568* Site: position = -70 score = 5.45647 sequence = AAGTGTAGCCGATGCTACATTG Gene: Spro_1916: Manganese transporter, NRAMP family Gene: Spro_3415: Manganese transporter, NRAMP family	Erwinia carotovora subsp. atroseptica SCRI1043 Gene: ECA0843: Manganese transporter, NRAMP family	Edwardsiella tarda EIB202 Gene: ETAE_1142: Manganese transporter, NRAMP family	Proteus mirabilis HI4320	Photorhabdus luminescens subsp. laumondii TTO1	Manganese transporter, NRAMP family

CRON 2.
mntR	* Escherichia coli str. K-12 substr. MG1655 Site: position = -129 score = 6.86638 sequence = AGATATAGCACAGGCTATATTA Gene: b0817: Manganese homeostasis transcriptional regulator MntR, DtxR family	* Salmonella typhimurium LT2 Site: position = -128 score = 6.82632 sequence = AGATATAGCACAGGCTATGTTT Gene: STM0835: Manganese homeostasis transcriptional regulator MntR, DtxR family	* Citrobacter koseri ATCC BAA-895 Site: position = -129 score = 6.86638 sequence = AGATATAGCACAGGCTATATTA Gene: CKO_02301: Manganese homeostasis transcriptional regulator MntR, DtxR family	* Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -163 score = 7.02758 sequence = AGATATAGCACAGGCTATATTT Gene: KPN_00845: Manganese homeostasis transcriptional regulator MntR, DtxR family	* Enterobacter sp. 638 Site: position = -128 score = 6.90652 sequence = AGATATAGCACAGGCTATATTG Gene: Ent638_1304: Manganese homeostasis transcriptional regulator MntR, DtxR family	* Erwinia amylovora ATCC 49946 Site: position = -137 score = 6.62302 sequence = AGATATAGCACAGGCTATATCG Gene: EAM_1275: Manganese homeostasis transcriptional regulator MntR, DtxR family	Yersinia pestis KIM	* Serratia proteamaculans 568 Site: position = -181 score = 5.30607 sequence = CAATGTAGCATCGGCTACACTT Gene: Spro_1915: Manganese homeostasis transcriptional regulator MntR, DtxR family	Erwinia carotovora subsp. atroseptica SCRI1043	Edwardsiella tarda EIB202	Proteus mirabilis HI4320	Photorhabdus luminescens subsp. laumondii TTO1	Manganese homeostasis transcriptional regulator MntR, DtxR family
ybiR	Escherichia coli str. K-12 substr. MG1655 Gene: b0818: Predicted divalent ion symporter, PF03600	Salmonella typhimurium LT2 Gene: STM0836: Predicted divalent ion symporter, PF03600	Citrobacter koseri ATCC BAA-895 Gene: CKO_02300: Predicted divalent ion symporter, PF03600	Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Gene: KPN_00846: Predicted divalent ion symporter, PF03600	Enterobacter sp. 638 Gene: Ent638_1305: Predicted divalent ion symporter, PF03600	Erwinia amylovora ATCC 49946	Yersinia pestis KIM	Serratia proteamaculans 568 Gene: Spro_3360: Predicted divalent ion symporter, PF03600	Erwinia carotovora subsp. atroseptica SCRI1043	Edwardsiella tarda EIB202 Gene: ETAE_1541: Predicted divalent ion symporter, PF03600	Proteus mirabilis HI4320	Photorhabdus luminescens subsp. laumondii TTO1	Predicted divalent ion symporter, PF03600

CRON 3.
sitA	Escherichia coli str. K-12 substr. MG1655	* Salmonella typhimurium LT2 Site: position = -57 score = 6.67954 sequence = TAACATAGCAAAGGCTATATTC Gene: STM2861: Iron and manganese ABC transporter, substrate-binding protein	2 Citrobacter koseri ATCC BAA-895* Site: position = -42 score = 6.67954 sequence = TAACATAGCAAAGGCTATATTC Gene: CKO_04090: Iron and manganese ABC transporter, substrate-binding protein Site: position = -88 score = 6.08658 sequence = AAATATAGCCTGTGCTATGTTG Gene: CKO_00940: Iron and manganese ABC transporter, substrate-binding protein	* Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -76 score = 4.65539 sequence = ATAAATAGCTTGTGCTATATAA Site: position = -57 score = 5.71966 sequence = TAACATAGCAATGGCTATAAAC Gene: KPN_03078: Iron and manganese ABC transporter, substrate-binding protein	* Enterobacter sp. 638 Site: position = -75 score = 6.2477 sequence = AAATATAGCCTATGCTATATAA Site: position = -56 score = 5.31523 sequence = TAAGATAGCACAGGCTAATTTT Gene: Ent638_1111: Iron and manganese ABC transporter, substrate-binding protein	* Erwinia amylovora ATCC 49946 Site: position = -54 score = 4.92093 sequence = TGTTATAGCAATTGCTATTTAG Site: position = -73 score = 5.60155 sequence = GGATATAGCCTGTGCTATATGT Gene: EAM_2087: Iron and manganese ABC transporter, substrate-binding protein	Yersinia pestis KIM Gene: y1897: Iron and manganese ABC transporter, substrate-binding protein	Serratia proteamaculans 568 Gene: Spro_2133: Iron and manganese ABC transporter, substrate-binding protein	Erwinia carotovora subsp. atroseptica SCRI1043 Gene: ECA2392: Iron and manganese ABC transporter, substrate-binding protein	Edwardsiella tarda EIB202	Proteus mirabilis HI4320 Gene: PMI1027: Iron and manganese ABC transporter, substrate-binding protein	Photorhabdus luminescens subsp. laumondii TTO1 Gene: plu2672: Iron and manganese ABC transporter, substrate-binding protein	Iron and manganese ABC transporter, substrate-binding protein
sitB	Escherichia coli str. K-12 substr. MG1655	Salmonella typhimurium LT2 Gene: STM2862: Iron and manganese ABC transporter, ATP-binding protein	2 Citrobacter koseri ATCC BAA-895 Gene: CKO_04091: Iron and manganese ABC transporter, ATP-binding protein Gene: CKO_00939: Iron and manganese ABC transporter, ATP-binding protein	Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Gene: KPN_03079: Iron and manganese ABC transporter, ATP-binding protein	Enterobacter sp. 638 Gene: Ent638_1112: Iron and manganese ABC transporter, ATP-binding protein	Erwinia amylovora ATCC 49946 Gene: EAM_2088: Iron and manganese ABC transporter, ATP-binding protein	Yersinia pestis KIM Gene: y1896: Iron and manganese ABC transporter, ATP-binding protein	Serratia proteamaculans 568 Gene: Spro_2132: Iron and manganese ABC transporter, ATP-binding protein	Erwinia carotovora subsp. atroseptica SCRI1043 Gene: ECA2393: Iron and manganese ABC transporter, ATP-binding protein	Edwardsiella tarda EIB202	Proteus mirabilis HI4320 Gene: PMI1026: Iron and manganese ABC transporter, ATP-binding protein	Photorhabdus luminescens subsp. laumondii TTO1 Gene: plu2673: Iron and manganese ABC transporter, ATP-binding protein	Iron and manganese ABC transporter, ATP-binding protein
sitC	Escherichia coli str. K-12 substr. MG1655	Salmonella typhimurium LT2 Gene: STM2863: Iron and manganese ABC transporter, permease protein 1	2 Citrobacter koseri ATCC BAA-895 Gene: CKO_04092: Iron and manganese ABC transporter, permease protein 1 Gene: CKO_00938: Iron and manganese ABC transporter, permease protein 1	Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Gene: KPN_03080: Iron and manganese ABC transporter, permease protein 1	Enterobacter sp. 638 Gene: Ent638_1113: Iron and manganese ABC transporter, permease protein 1	Erwinia amylovora ATCC 49946 Gene: EAM_2089: Iron and manganese ABC transporter, permease protein 1	Yersinia pestis KIM Gene: y1895: Iron and manganese ABC transporter, permease protein 1	Serratia proteamaculans 568 Gene: Spro_2131: Iron and manganese ABC transporter, permease protein 1	Erwinia carotovora subsp. atroseptica SCRI1043 Gene: ECA2394: Iron and manganese ABC transporter, permease protein 1	Edwardsiella tarda EIB202	Proteus mirabilis HI4320 Gene: PMI1025: Iron and manganese ABC transporter, permease protein 1	Photorhabdus luminescens subsp. laumondii TTO1 Gene: plu2674: Iron and manganese ABC transporter, permease protein 1	Iron and manganese ABC transporter, permease protein 1
sitD	Escherichia coli str. K-12 substr. MG1655	Salmonella typhimurium LT2 Gene: STM2864: Iron and manganese ABC transporter, permease protein 2	2 Citrobacter koseri ATCC BAA-895 Gene: CKO_04093: Iron and manganese ABC transporter, permease protein 2 Gene: CKO_00937: Iron and manganese ABC transporter, permease protein 2	Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Gene: KPN_03081: Iron and manganese ABC transporter, permease protein 2	Enterobacter sp. 638 Gene: Ent638_1114: Iron and manganese ABC transporter, permease protein 2	Erwinia amylovora ATCC 49946 Gene: EAM_2090: Iron and manganese ABC transporter, permease protein 2	Yersinia pestis KIM Gene: y1894: Iron and manganese ABC transporter, permease protein 2	Serratia proteamaculans 568 Gene: Spro_2130: Iron and manganese ABC transporter, permease protein 2	Erwinia carotovora subsp. atroseptica SCRI1043 Gene: ECA2395: Iron and manganese ABC transporter, permease protein 2	Edwardsiella tarda EIB202	Proteus mirabilis HI4320 Gene: PMI1024: Iron and manganese ABC transporter, permease protein 2	Photorhabdus luminescens subsp. laumondii TTO1 Gene: plu2675: Iron and manganese ABC transporter, permease protein 2	Iron and manganese ABC transporter, permease protein 2

CRON 4.
dps	* Escherichia coli str. K-12 substr. MG1655 Site: position = -67 score = 5.26937 sequence = ACACATAGCCGGTGCTATACTT Gene: b0812: Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1)	Salmonella typhimurium LT2 Gene: STM0831: Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1)	Citrobacter koseri ATCC BAA-895 Gene: CKO_02310: Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1)	Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Gene: KPN_00841: Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1)	Enterobacter sp. 638 Gene: Ent638_1299: Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1)	Erwinia amylovora ATCC 49946 Gene: EAM_1272: Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1)	Yersinia pestis KIM Gene: y1677: Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1)	Serratia proteamaculans 568 Gene: Spro_1481: Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1)	Erwinia carotovora subsp. atroseptica SCRI1043 Gene: ECA2767: Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1)	Edwardsiella tarda EIB202 Gene: ETAE_1821: Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1)	Proteus mirabilis HI4320 Gene: PMI0631: Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1)	Photorhabdus luminescens subsp. laumondii TTO1	Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1)

CRON 5.
mntP	* Escherichia coli str. K-12 substr. MG1655 Site: position = -383 score = 6.19676 sequence = AGACATAGCTTAGGCTATATTA Site: position = -423 score = 5.32733 sequence = GAATTTAGCCAAAGCTATGTTT Gene: b1821: Manganese efflux pump	* Salmonella typhimurium LT2 Site: position = -308 score = 6.39727 sequence = TAATATAGCTAAGGCTATATTT Site: position = -351 score = 5.12319 sequence = AGATATAGCCTCAACTATGTTT Gene: STM1834: Manganese efflux pump	* Citrobacter koseri ATCC BAA-895 Site: position = -373 score = 6.38309 sequence = AAACATAGCTAAGGCTATATTC Site: position = -416 score = 5.20166 sequence = AGATATAGCCTGAACTATGTTT Gene: CKO_01156: Manganese efflux pump	* Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -449 score = 5.9927 sequence = AAATATAGCCAGCGCTATATTA Site: position = -406 score = 5.81409 sequence = TATTATAGCCACGGCTATATTT Gene: KPN_02337: Manganese efflux pump	* Enterobacter sp. 638 Site: position = -313 score = 5.50111 sequence = ATATATAGCCATCGCTATATTC Site: position = -356 score = 6.33319 sequence = AATTATAGCAGAGGCTATATTT Gene: Ent638_2390: Manganese efflux pump	* Erwinia amylovora ATCC 49946 Site: position = -168 score = 5.65227 sequence = AAGTATAGCCGATGCTATAATC Gene: EAM_3371: Manganese efflux pump	Yersinia pestis KIM Gene: y2555: Manganese efflux pump	Serratia proteamaculans 568 Gene: Spro_2817: Manganese efflux pump	Erwinia carotovora subsp. atroseptica SCRI1043 Gene: ECA2389: Manganese efflux pump	Edwardsiella tarda EIB202	Proteus mirabilis HI4320 Gene: PMI1608: Manganese efflux pump	Photorhabdus luminescens subsp. laumondii TTO1 Gene: plu2701: Manganese efflux pump	Manganese efflux pump

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog MntR - Enterobacteriales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --