Regulog MntR - Enterobacteriales
| Regulator type: | Transcription factor |
| Regulator family: | DtxR |
| Regulation mode: | repressor |
| Biological process: | Manganese homeostasis |
| Effector: | Manganese ion, (Mn2+) |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Enterobacteriales
- By trascription factor - MntR
- By TF family - DtxR
- By effector - Manganese ion, (Mn2+)
- By pathway - Manganese homeostasis
| Genome | Genes | Operons |
|---|---|---|
| Escherichia coli str. K-12 substr. MG1655 | 5 | 4 |
| Salmonella typhimurium LT2 | 8 | 4 |
| Citrobacter koseri ATCC BAA-895 | 12 | 5 |
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | 8 | 4 |
| Enterobacter sp. 638 | 8 | 4 |
| Erwinia amylovora ATCC 49946 | 7 | 4 |
| Yersinia pestis KIM | ||
| Serratia proteamaculans 568 | 2 | 2 |
| Erwinia carotovora subsp. atroseptica SCRI1043 | ||
| Edwardsiella tarda EIB202 | ||
| Proteus mirabilis HI4320 | ||
| Photorhabdus luminescens subsp. laumondii TTO1 |
| Genes | Function | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||
| mntH |
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -34 score = 6.86993 sequence = AAACATAGCAAAGGCTATGTTT Gene: b2392: Manganese transporter, NRAMP family |
*
Salmonella typhimurium LT2 Site: position = -34 score = 6.86993 sequence = AAACATAGCAAAGGCTATGTTT Gene: STM2408: Manganese transporter, NRAMP family |
*
Citrobacter koseri ATCC BAA-895 Site: position = -16 score = 6.86993 sequence = AAACATAGCAAAGGCTATGTTT Gene: CKO_00404: Manganese transporter, NRAMP family |
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -35 score = 7.07119 sequence = AAACATAGCAAAGGCTATATTT Gene: KPN_02743: Manganese transporter, NRAMP family |
*
Enterobacter sp. 638 Site: position = -34 score = 6.78768 sequence = AAACATAGCAAAGGCTATATCT Gene: Ent638_2926: Manganese transporter, NRAMP family |
*
Erwinia amylovora ATCC 49946 Site: position = -133 score = 6.39868 sequence = AAGTATAGCAATTGCTATATTT Gene: EAM_2378: Manganese transporter, NRAMP family |
Gene: y1500: Manganese transporter, NRAMP family |
*2
Serratia proteamaculans 568 Site: position = -70 score = 5.45647 sequence = AAGTGTAGCCGATGCTACATTG Gene: Spro_1916: Manganese transporter, NRAMP family Gene: Spro_3415: Manganese transporter, NRAMP family |
Gene: ECA0843: Manganese transporter, NRAMP family |
Gene: ETAE_1142: Manganese transporter, NRAMP family |
|
|
Manganese transporter, NRAMP family |
| CRON 2. | |||||||||||||
| mntR |
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -129 score = 6.86638 sequence = AGATATAGCACAGGCTATATTA Gene: b0817: Manganese homeostasis transcriptional regulator MntR, DtxR family |
*
Salmonella typhimurium LT2 Site: position = -128 score = 6.82632 sequence = AGATATAGCACAGGCTATGTTT Gene: STM0835: Manganese homeostasis transcriptional regulator MntR, DtxR family |
*
Citrobacter koseri ATCC BAA-895 Site: position = -129 score = 6.86638 sequence = AGATATAGCACAGGCTATATTA Gene: CKO_02301: Manganese homeostasis transcriptional regulator MntR, DtxR family |
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -163 score = 7.02758 sequence = AGATATAGCACAGGCTATATTT Gene: KPN_00845: Manganese homeostasis transcriptional regulator MntR, DtxR family |
*
Enterobacter sp. 638 Site: position = -128 score = 6.90652 sequence = AGATATAGCACAGGCTATATTG Gene: Ent638_1304: Manganese homeostasis transcriptional regulator MntR, DtxR family |
*
Erwinia amylovora ATCC 49946 Site: position = -137 score = 6.62302 sequence = AGATATAGCACAGGCTATATCG Gene: EAM_1275: Manganese homeostasis transcriptional regulator MntR, DtxR family |
|
*
Serratia proteamaculans 568 Site: position = -181 score = 5.30607 sequence = CAATGTAGCATCGGCTACACTT Gene: Spro_1915: Manganese homeostasis transcriptional regulator MntR, DtxR family |
|
|
|
|
Manganese homeostasis transcriptional regulator MntR, DtxR family |
| ybiR |
Gene: b0818: Predicted divalent ion symporter, PF03600 |
Gene: STM0836: Predicted divalent ion symporter, PF03600 |
Gene: CKO_02300: Predicted divalent ion symporter, PF03600 |
Gene: KPN_00846: Predicted divalent ion symporter, PF03600 |
Gene: Ent638_1305: Predicted divalent ion symporter, PF03600 |
|
|
Gene: Spro_3360: Predicted divalent ion symporter, PF03600 |
|
Gene: ETAE_1541: Predicted divalent ion symporter, PF03600 |
|
|
Predicted divalent ion symporter, PF03600 |
| CRON 3. | |||||||||||||
| sitA |
|
*
Salmonella typhimurium LT2 Site: position = -57 score = 6.67954 sequence = TAACATAGCAAAGGCTATATTC Gene: STM2861: Iron and manganese ABC transporter, substrate-binding protein |
*2
Citrobacter koseri ATCC BAA-895 Site: position = -42 score = 6.67954 sequence = TAACATAGCAAAGGCTATATTC Gene: CKO_04090: Iron and manganese ABC transporter, substrate-binding protein Site: position = -88 score = 6.08658 sequence = AAATATAGCCTGTGCTATGTTG Gene: CKO_00940: Iron and manganese ABC transporter, substrate-binding protein |
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -76 score = 4.65539 sequence = ATAAATAGCTTGTGCTATATAA Site: position = -57 score = 5.71966 sequence = TAACATAGCAATGGCTATAAAC Gene: KPN_03078: Iron and manganese ABC transporter, substrate-binding protein |
*
Enterobacter sp. 638 Site: position = -75 score = 6.2477 sequence = AAATATAGCCTATGCTATATAA Site: position = -56 score = 5.31523 sequence = TAAGATAGCACAGGCTAATTTT Gene: Ent638_1111: Iron and manganese ABC transporter, substrate-binding protein |
*
Erwinia amylovora ATCC 49946 Site: position = -54 score = 4.92093 sequence = TGTTATAGCAATTGCTATTTAG Site: position = -73 score = 5.60155 sequence = GGATATAGCCTGTGCTATATGT Gene: EAM_2087: Iron and manganese ABC transporter, substrate-binding protein |
Gene: y1897: Iron and manganese ABC transporter, substrate-binding protein |
Gene: Spro_2133: Iron and manganese ABC transporter, substrate-binding protein |
Gene: ECA2392: Iron and manganese ABC transporter, substrate-binding protein |
|
Gene: PMI1027: Iron and manganese ABC transporter, substrate-binding protein |
Gene: plu2672: Iron and manganese ABC transporter, substrate-binding protein |
Iron and manganese ABC transporter, substrate-binding protein |
| sitB |
|
Gene: STM2862: Iron and manganese ABC transporter, ATP-binding protein |
2
Citrobacter koseri ATCC BAA-895 Gene: CKO_04091: Iron and manganese ABC transporter, ATP-binding protein Gene: CKO_00939: Iron and manganese ABC transporter, ATP-binding protein |
Gene: KPN_03079: Iron and manganese ABC transporter, ATP-binding protein |
Gene: Ent638_1112: Iron and manganese ABC transporter, ATP-binding protein |
Gene: EAM_2088: Iron and manganese ABC transporter, ATP-binding protein |
Gene: y1896: Iron and manganese ABC transporter, ATP-binding protein |
Gene: Spro_2132: Iron and manganese ABC transporter, ATP-binding protein |
Gene: ECA2393: Iron and manganese ABC transporter, ATP-binding protein |
|
Gene: PMI1026: Iron and manganese ABC transporter, ATP-binding protein |
Gene: plu2673: Iron and manganese ABC transporter, ATP-binding protein |
Iron and manganese ABC transporter, ATP-binding protein |
| sitC |
|
Gene: STM2863: Iron and manganese ABC transporter, permease protein 1 |
2
Citrobacter koseri ATCC BAA-895 Gene: CKO_04092: Iron and manganese ABC transporter, permease protein 1 Gene: CKO_00938: Iron and manganese ABC transporter, permease protein 1 |
Gene: KPN_03080: Iron and manganese ABC transporter, permease protein 1 |
Gene: Ent638_1113: Iron and manganese ABC transporter, permease protein 1 |
Gene: EAM_2089: Iron and manganese ABC transporter, permease protein 1 |
Gene: y1895: Iron and manganese ABC transporter, permease protein 1 |
Gene: Spro_2131: Iron and manganese ABC transporter, permease protein 1 |
Gene: ECA2394: Iron and manganese ABC transporter, permease protein 1 |
|
Gene: PMI1025: Iron and manganese ABC transporter, permease protein 1 |
Gene: plu2674: Iron and manganese ABC transporter, permease protein 1 |
Iron and manganese ABC transporter, permease protein 1 |
| sitD |
|
Gene: STM2864: Iron and manganese ABC transporter, permease protein 2 |
2
Citrobacter koseri ATCC BAA-895 Gene: CKO_04093: Iron and manganese ABC transporter, permease protein 2 Gene: CKO_00937: Iron and manganese ABC transporter, permease protein 2 |
Gene: KPN_03081: Iron and manganese ABC transporter, permease protein 2 |
Gene: Ent638_1114: Iron and manganese ABC transporter, permease protein 2 |
Gene: EAM_2090: Iron and manganese ABC transporter, permease protein 2 |
Gene: y1894: Iron and manganese ABC transporter, permease protein 2 |
Gene: Spro_2130: Iron and manganese ABC transporter, permease protein 2 |
Gene: ECA2395: Iron and manganese ABC transporter, permease protein 2 |
|
Gene: PMI1024: Iron and manganese ABC transporter, permease protein 2 |
Gene: plu2675: Iron and manganese ABC transporter, permease protein 2 |
Iron and manganese ABC transporter, permease protein 2 |
| CRON 4. | |||||||||||||
| dps |
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -67 score = 5.26937 sequence = ACACATAGCCGGTGCTATACTT Gene: b0812: Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1) |
Gene: STM0831: Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1) |
Gene: CKO_02310: Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1) |
Gene: KPN_00841: Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1) |
Gene: Ent638_1299: Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1) |
Gene: EAM_1272: Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1) |
Gene: y1677: Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1) |
Gene: Spro_1481: Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1) |
Gene: ECA2767: Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1) |
Gene: ETAE_1821: Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1) |
Gene: PMI0631: Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1) |
|
Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1) |
| CRON 5. | |||||||||||||
| mntP |
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -383 score = 6.19676 sequence = AGACATAGCTTAGGCTATATTA Site: position = -423 score = 5.32733 sequence = GAATTTAGCCAAAGCTATGTTT Gene: b1821: Manganese efflux pump |
*
Salmonella typhimurium LT2 Site: position = -308 score = 6.39727 sequence = TAATATAGCTAAGGCTATATTT Site: position = -351 score = 5.12319 sequence = AGATATAGCCTCAACTATGTTT Gene: STM1834: Manganese efflux pump |
*
Citrobacter koseri ATCC BAA-895 Site: position = -373 score = 6.38309 sequence = AAACATAGCTAAGGCTATATTC Site: position = -416 score = 5.20166 sequence = AGATATAGCCTGAACTATGTTT Gene: CKO_01156: Manganese efflux pump |
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -449 score = 5.9927 sequence = AAATATAGCCAGCGCTATATTA Site: position = -406 score = 5.81409 sequence = TATTATAGCCACGGCTATATTT Gene: KPN_02337: Manganese efflux pump |
*
Enterobacter sp. 638 Site: position = -313 score = 5.50111 sequence = ATATATAGCCATCGCTATATTC Site: position = -356 score = 6.33319 sequence = AATTATAGCAGAGGCTATATTT Gene: Ent638_2390: Manganese efflux pump |
*
Erwinia amylovora ATCC 49946 Site: position = -168 score = 5.65227 sequence = AAGTATAGCCGATGCTATAATC Gene: EAM_3371: Manganese efflux pump |
Gene: y2555: Manganese efflux pump |
Gene: Spro_2817: Manganese efflux pump |
Gene: ECA2389: Manganese efflux pump |
|
Gene: PMI1608: Manganese efflux pump |
Gene: plu2701: Manganese efflux pump |
Manganese efflux pump |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |