Regulon of MntR in Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Properties
Regulator type:	Transcription factor
TF locus tag:	KPN_00845
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Manganese homeostasis
Effector:	Manganese ion, (Mn2+)
Regulog:	MntR - Enterobacteriales
Statistics of regulated genes:
- Genes	8
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 35 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By trascription factor - MntR
By TF family - DtxR
By effector - Manganese ion, (Mn2+)
By pathway - Manganese homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -35 Score: 7.1 Sequence: AAACATAGCAAAGGCTATATTT Locus tag: KPN_02743 Name: mntH Funciton: Manganese transporter, NRAMP family
	KPN_02743	mntH	Manganese transporter, NRAMP family
Position: -76 Score: 4.7 Sequence: ATAAATAGCTTGTGCTATATAA Position: -57 Score: 5.7 Sequence: TAACATAGCAATGGCTATAAAC Locus tag: KPN_03078 Name: sitA Funciton: Iron and manganese ABC transporter, substrate-binding protein Locus tag: KPN_03079 Name: sitB Funciton: Iron and manganese ABC transporter, ATP-binding protein Locus tag: KPN_03080 Name: sitC Funciton: Iron and manganese ABC transporter, permease protein 1 Locus tag: KPN_03081 Name: sitD Funciton: Iron and manganese ABC transporter, permease protein 2
	KPN_03078	sitA	Iron and manganese ABC transporter, substrate-binding protein
	KPN_03079	sitB	Iron and manganese ABC transporter, ATP-binding protein
	KPN_03080	sitC	Iron and manganese ABC transporter, permease protein 1
	KPN_03081	sitD	Iron and manganese ABC transporter, permease protein 2
Position: -163 Score: 7 Sequence: AGATATAGCACAGGCTATATTT Locus tag: KPN_00845 Name: mntR Funciton: Manganese homeostasis transcriptional regulator MntR, DtxR family Locus tag: KPN_00846 Name: ybiR Funciton: Predicted divalent ion symporter, PF03600
	KPN_00845	mntR	Manganese homeostasis transcriptional regulator MntR, DtxR family
	KPN_00846	ybiR	Predicted divalent ion symporter, PF03600
Position: -449 Score: 6 Sequence: AAATATAGCCAGCGCTATATTA Position: -406 Score: 5.8 Sequence: TATTATAGCCACGGCTATATTT Locus tag: KPN_02337 Name: mntP Funciton: Manganese efflux pump
	KPN_02337	mntP	Manganese efflux pump

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD