Regulon of MntR in Citrobacter koseri ATCC BAA-895

Properties
Regulator type:	Transcription factor
TF locus tag:	CKO_02301
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Manganese homeostasis
Effector:	Manganese ion, (Mn2+)
Regulog:	MntR - Enterobacteriales
Statistics of regulated genes:
- Genes	12
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 35 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By trascription factor - MntR
By TF family - DtxR
By effector - Manganese ion, (Mn2+)
By pathway - Manganese homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -16 Score: 6.9 Sequence: AAACATAGCAAAGGCTATGTTT Locus tag: CKO_00404 Name: mntH Funciton: Manganese transporter, NRAMP family
	CKO_00404	mntH	Manganese transporter, NRAMP family
Position: -42 Score: 6.7 Sequence: TAACATAGCAAAGGCTATATTC Locus tag: CKO_04090 Name: sitA Funciton: Iron and manganese ABC transporter, substrate-binding protein Locus tag: CKO_04091 Name: sitB Funciton: Iron and manganese ABC transporter, ATP-binding protein Locus tag: CKO_04092 Name: sitC Funciton: Iron and manganese ABC transporter, permease protein 1 Locus tag: CKO_04093 Name: sitD Funciton: Iron and manganese ABC transporter, permease protein 2
	CKO_04090	sitA	Iron and manganese ABC transporter, substrate-binding protein
	CKO_04091	sitB	Iron and manganese ABC transporter, ATP-binding protein
	CKO_04092	sitC	Iron and manganese ABC transporter, permease protein 1
	CKO_04093	sitD	Iron and manganese ABC transporter, permease protein 2
Position: -88 Score: 6.1 Sequence: AAATATAGCCTGTGCTATGTTG Locus tag: CKO_00940 Name: sitA Funciton: Iron and manganese ABC transporter, substrate-binding protein Locus tag: CKO_00939 Name: sitB Funciton: Iron and manganese ABC transporter, ATP-binding protein Locus tag: CKO_00938 Name: sitC Funciton: Iron and manganese ABC transporter, permease protein 1 Locus tag: CKO_00937 Name: sitD Funciton: Iron and manganese ABC transporter, permease protein 2
	CKO_00940	sitA	Iron and manganese ABC transporter, substrate-binding protein
	CKO_00939	sitB	Iron and manganese ABC transporter, ATP-binding protein
	CKO_00938	sitC	Iron and manganese ABC transporter, permease protein 1
	CKO_00937	sitD	Iron and manganese ABC transporter, permease protein 2
Position: -129 Score: 6.9 Sequence: AGATATAGCACAGGCTATATTA Locus tag: CKO_02301 Name: mntR Funciton: Manganese homeostasis transcriptional regulator MntR, DtxR family Locus tag: CKO_02300 Name: ybiR Funciton: Predicted divalent ion symporter, PF03600
	CKO_02301	mntR	Manganese homeostasis transcriptional regulator MntR, DtxR family
	CKO_02300	ybiR	Predicted divalent ion symporter, PF03600
Position: -416 Score: 5.2 Sequence: AGATATAGCCTGAACTATGTTT Position: -373 Score: 6.4 Sequence: AAACATAGCTAAGGCTATATTC Locus tag: CKO_01156 Name: mntP Funciton: Manganese efflux pump
	CKO_01156	mntP	Manganese efflux pump

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD