Regulon of MntR in Enterobacter sp. 638

Properties
Regulator type:	Transcription factor
TF locus tag:	Ent638_1304
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Manganese homeostasis
Effector:	Manganese ion, (Mn2+)
Regulog:	MntR - Enterobacteriales
Statistics of regulated genes:
- Genes	8
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 35 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By trascription factor - MntR
By TF family - DtxR
By effector - Manganese ion, (Mn2+)
By pathway - Manganese homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -34 Score: 6.8 Sequence: AAACATAGCAAAGGCTATATCT Locus tag: Ent638_2926 Name: mntH Funciton: Manganese transporter, NRAMP family
	Ent638_2926	mntH	Manganese transporter, NRAMP family
Position: -75 Score: 6.2 Sequence: AAATATAGCCTATGCTATATAA Position: -56 Score: 5.3 Sequence: TAAGATAGCACAGGCTAATTTT Locus tag: Ent638_1111 Name: sitA Funciton: Iron and manganese ABC transporter, substrate-binding protein Locus tag: Ent638_1112 Name: sitB Funciton: Iron and manganese ABC transporter, ATP-binding protein Locus tag: Ent638_1113 Name: sitC Funciton: Iron and manganese ABC transporter, permease protein 1 Locus tag: Ent638_1114 Name: sitD Funciton: Iron and manganese ABC transporter, permease protein 2
	Ent638_1111	sitA	Iron and manganese ABC transporter, substrate-binding protein
	Ent638_1112	sitB	Iron and manganese ABC transporter, ATP-binding protein
	Ent638_1113	sitC	Iron and manganese ABC transporter, permease protein 1
	Ent638_1114	sitD	Iron and manganese ABC transporter, permease protein 2
Position: -128 Score: 6.9 Sequence: AGATATAGCACAGGCTATATTG Locus tag: Ent638_1304 Name: mntR Funciton: Manganese homeostasis transcriptional regulator MntR, DtxR family Locus tag: Ent638_1305 Name: ybiR Funciton: Predicted divalent ion symporter, PF03600
	Ent638_1304	mntR	Manganese homeostasis transcriptional regulator MntR, DtxR family
	Ent638_1305	ybiR	Predicted divalent ion symporter, PF03600
Position: -356 Score: 6.3 Sequence: AATTATAGCAGAGGCTATATTT Position: -313 Score: 5.5 Sequence: ATATATAGCCATCGCTATATTC Locus tag: Ent638_2390 Name: mntP Funciton: Manganese efflux pump
	Ent638_2390	mntP	Manganese efflux pump

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD