Regulon of MntR in Salmonella typhimurium LT2

Properties
Regulator type:	Transcription factor
TF locus tag:	STM0835
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Manganese homeostasis
Effector:	Manganese ion, (Mn2+)
Regulog:	MntR - Enterobacteriales
Statistics of regulated genes:
- Genes	8
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 35 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By trascription factor - MntR
By TF family - DtxR
By effector - Manganese ion, (Mn2+)
By pathway - Manganese homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -34 Score: 6.9 Sequence: AAACATAGCAAAGGCTATGTTT Locus tag: STM2408 Name: mntH Funciton: Manganese transporter, NRAMP family
	STM2408	mntH	Manganese transporter, NRAMP family
Position: -128 Score: 6.8 Sequence: AGATATAGCACAGGCTATGTTT Locus tag: STM0835 Name: mntR Funciton: Manganese homeostasis transcriptional regulator MntR, DtxR family Locus tag: STM0836 Name: ybiR Funciton: Predicted divalent ion symporter, PF03600
	STM0835	mntR	Manganese homeostasis transcriptional regulator MntR, DtxR family
	STM0836	ybiR	Predicted divalent ion symporter, PF03600
Position: -57 Score: 6.7 Sequence: TAACATAGCAAAGGCTATATTC Locus tag: STM2861 Name: sitA Funciton: Iron and manganese ABC transporter, substrate-binding protein Locus tag: STM2862 Name: sitB Funciton: Iron and manganese ABC transporter, ATP-binding protein Locus tag: STM2863 Name: sitC Funciton: Iron and manganese ABC transporter, permease protein 1 Locus tag: STM2864 Name: sitD Funciton: Iron and manganese ABC transporter, permease protein 2
	STM2861	sitA	Iron and manganese ABC transporter, substrate-binding protein
	STM2862	sitB	Iron and manganese ABC transporter, ATP-binding protein
	STM2863	sitC	Iron and manganese ABC transporter, permease protein 1
	STM2864	sitD	Iron and manganese ABC transporter, permease protein 2
Position: -351 Score: 5.1 Sequence: AGATATAGCCTCAACTATGTTT Position: -308 Score: 6.4 Sequence: TAATATAGCTAAGGCTATATTT Locus tag: STM1834 Name: mntP Funciton: Manganese efflux pump
	STM1834	mntP	Manganese efflux pump

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD