Regulon of MntR in Erwinia amylovora ATCC 49946

Properties
Regulator type:	Transcription factor
TF locus tag:	EAM_1275
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Manganese homeostasis
Effector:	Manganese ion, (Mn2+)
Regulog:	MntR - Enterobacteriales
Statistics of regulated genes:
- Genes	7
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 35 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By trascription factor - MntR
By TF family - DtxR
By effector - Manganese ion, (Mn2+)
By pathway - Manganese homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -133 Score: 6.4 Sequence: AAGTATAGCAATTGCTATATTT Locus tag: EAM_2378 Name: mntH Funciton: Manganese transporter, NRAMP family
	EAM_2378	mntH	Manganese transporter, NRAMP family
Position: -137 Score: 6.6 Sequence: AGATATAGCACAGGCTATATCG Locus tag: EAM_1275 Name: mntR Funciton: Manganese homeostasis transcriptional regulator MntR, DtxR family
	EAM_1275	mntR	Manganese homeostasis transcriptional regulator MntR, DtxR family
Position: -73 Score: 5.6 Sequence: GGATATAGCCTGTGCTATATGT Position: -54 Score: 4.9 Sequence: TGTTATAGCAATTGCTATTTAG Locus tag: EAM_2087 Name: sitA Funciton: Iron and manganese ABC transporter, substrate-binding protein Locus tag: EAM_2088 Name: sitB Funciton: Iron and manganese ABC transporter, ATP-binding protein Locus tag: EAM_2089 Name: sitC Funciton: Iron and manganese ABC transporter, permease protein 1 Locus tag: EAM_2090 Name: sitD Funciton: Iron and manganese ABC transporter, permease protein 2
	EAM_2087	sitA	Iron and manganese ABC transporter, substrate-binding protein
	EAM_2088	sitB	Iron and manganese ABC transporter, ATP-binding protein
	EAM_2089	sitC	Iron and manganese ABC transporter, permease protein 1
	EAM_2090	sitD	Iron and manganese ABC transporter, permease protein 2
Position: -168 Score: 5.7 Sequence: AAGTATAGCCGATGCTATAATC Locus tag: EAM_3371 Name: mntP Funciton: Manganese efflux pump
	EAM_3371	mntP	Manganese efflux pump

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD