Regulon of MntR in Serratia proteamaculans 568

Properties
Regulator type:	Transcription factor
TF locus tag:	Spro_1915
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Manganese homeostasis
Effector:	Manganese ion, (Mn2+)
Regulog:	MntR - Enterobacteriales
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 35 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By trascription factor - MntR
By TF family - DtxR
By effector - Manganese ion, (Mn2+)
By pathway - Manganese homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -70 Score: 5.5 Sequence: AAGTGTAGCCGATGCTACATTG Locus tag: Spro_1916 Name: mntH Funciton: Manganese transporter, NRAMP family
	Spro_1916	mntH	Manganese transporter, NRAMP family
Position: -181 Score: 5.3 Sequence: CAATGTAGCATCGGCTACACTT Locus tag: Spro_1915 Name: mntR Funciton: Manganese homeostasis transcriptional regulator MntR, DtxR family
	Spro_1915	mntR	Manganese homeostasis transcriptional regulator MntR, DtxR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD