Regulon of MntR in Escherichia coli str. K-12 substr. MG1655

Properties
Regulator type:	Transcription factor
TF locus tag:	b0817
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Manganese homeostasis
Effector:	Manganese ion, (Mn2+)
Regulog:	MntR - Enterobacteriales
Statistics of regulated genes:
- Genes	5
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 35 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By trascription factor - MntR
By TF family - DtxR
By effector - Manganese ion, (Mn2+)
By pathway - Manganese homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -34 Score: 6.9 Sequence: AAACATAGCAAAGGCTATGTTT Locus tag: b2392 Name: mntH Funciton: Manganese transporter, NRAMP family
	b2392	mntH	Manganese transporter, NRAMP family
Position: -129 Score: 6.9 Sequence: AGATATAGCACAGGCTATATTA Locus tag: b0817 Name: mntR Funciton: Manganese homeostasis transcriptional regulator MntR, DtxR family Locus tag: b0818 Name: ybiR Funciton: Predicted divalent ion symporter, PF03600
	b0817	mntR	Manganese homeostasis transcriptional regulator MntR, DtxR family
	b0818	ybiR	Predicted divalent ion symporter, PF03600
Position: -423 Score: 5.3 Sequence: GAATTTAGCCAAAGCTATGTTT Position: -383 Score: 6.2 Sequence: AGACATAGCTTAGGCTATATTA Locus tag: b1821 Name: mntP Funciton: Manganese efflux pump
	b1821	mntP	Manganese efflux pump
Position: -67 Score: 5.3 Sequence: ACACATAGCCGGTGCTATACTT Locus tag: b0812 Name: dps Funciton: Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1)
	b0812	dps	Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD