Regulog TyrR - Enterobacteriales
| Regulator type: | Transcription factor |
| Regulator family: | TyrR |
| Regulation mode: | activator (repressor) |
| Biological process: | Aromatic amino acid metabolism |
| Effector: | Tyrosine; Phenylalanine |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By trascription factor - TyrR
- By taxonomy - Enterobacteriales
- By TF family - TyrR
- By effector - Tyrosine
- By effector - Phenylalanine
- By pathway - Aromatic amino acid metabolism
| Genome | Genes | Operons |
|---|---|---|
| Escherichia coli str. K-12 substr. MG1655 | 11 | 8 |
| Salmonella typhimurium LT2 | 11 | 8 |
| Citrobacter koseri ATCC BAA-895 | 13 | 10 |
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | 11 | 8 |
| Enterobacter sp. 638 | 11 | 8 |
| Erwinia amylovora ATCC 49946 | 6 | 4 |
| Yersinia pestis KIM | 6 | 5 |
| Serratia proteamaculans 568 | 7 | 6 |
| Erwinia carotovora subsp. atroseptica SCRI1043 | 5 | 4 |
| Edwardsiella tarda EIB202 | 5 | 4 |
| Proteus mirabilis HI4320 | 6 | 5 |
| Photorhabdus luminescens subsp. laumondii TTO1 | 5 | 4 |
| Genes | Function | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||
| folA |
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -182 score = 4.47352 sequence = ACGTAAATCACACTTTACAG Gene: b0048: Dihydrofolate reductase (EC 1.5.1.3) |
Gene: STM0087: Dihydrofolate reductase (EC 1.5.1.3) |
Gene: CKO_03333: Dihydrofolate reductase (EC 1.5.1.3) |
Gene: KPN_00045: Dihydrofolate reductase (EC 1.5.1.3) |
Gene: Ent638_0597: Dihydrofolate reductase (EC 1.5.1.3) |
Gene: EAM_0663: Dihydrofolate reductase (EC 1.5.1.3) |
Gene: y3688: Dihydrofolate reductase (EC 1.5.1.3) |
Gene: Spro_0720: Dihydrofolate reductase (EC 1.5.1.3) |
Gene: ECA3864: Dihydrofolate reductase (EC 1.5.1.3) |
Gene: ETAE_0597: Dihydrofolate reductase (EC 1.5.1.3) |
Gene: PMI2337: Dihydrofolate reductase (EC 1.5.1.3) |
Gene: plu0606: Dihydrofolate reductase (EC 1.5.1.3) |
Dihydrofolate reductase (EC 1.5.1.3) |
| CRON 2. | |||||||||||||
| tyrR |
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -89 score = 3.71545 sequence = GTGTCAATGATTGTTGACAG Gene: b1323: Transcriptional regulator of aromatic amino acid biosynthesis |
*
Salmonella typhimurium LT2 Site: position = -89 score = 4.24636 sequence = CTGTCAATATTTGTTGACAG Gene: STM1683: Transcriptional regulator of aromatic amino acid biosynthesis |
*
Citrobacter koseri ATCC BAA-895 Site: position = -90 score = 4.18501 sequence = CTGTCAATAATTGTTGACAG Gene: CKO_01393: Transcriptional regulator of aromatic amino acid biosynthesis |
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -90 score = 4.18501 sequence = CTGTCAATAATTGTTGACAG Gene: KPN_01305: Transcriptional regulator of aromatic amino acid biosynthesis |
*
Enterobacter sp. 638 Site: position = -86 score = 3.74255 sequence = CTGTCAATATCTGTTGACAG Gene: Ent638_2152: Transcriptional regulator of aromatic amino acid biosynthesis |
*
Erwinia amylovora ATCC 49946 Site: position = -96 score = 3.89869 sequence = CTGTCAACTTTTCATGACAG Gene: EAM_1834: Transcriptional regulator of aromatic amino acid biosynthesis |
Gene: y1988: Transcriptional regulator of aromatic amino acid biosynthesis |
*
Serratia proteamaculans 568 Site: position = -98 score = 3.63207 sequence = CTGTCAACTTTTGCTGACAG Gene: Spro_2617: Transcriptional regulator of aromatic amino acid biosynthesis |
Gene: ECA1989: Transcriptional regulator of aromatic amino acid biosynthesis |
Gene: ETAE_1860: Transcriptional regulator of aromatic amino acid biosynthesis |
*
Proteus mirabilis HI4320 Site: position = -96 score = 3.72064 sequence = GTGTCAACTTTTGCTGACAA Gene: PMI1369: Transcriptional regulator of aromatic amino acid biosynthesis |
*
Photorhabdus luminescens subsp. laumondii TTO1 Site: position = -178 score = 3.67604 sequence = TTTTATAATCAATCTTACAA Gene: plu2580: Transcriptional regulator of aromatic amino acid biosynthesis |
Transcriptional regulator of aromatic amino acid biosynthesis |
| CRON 3. | |||||||||||||
| COG2814 |
|
|
*
Citrobacter koseri ATCC BAA-895 Site: position = -65 score = 4.90211 sequence = TAGTAATTTTTGATTTACAC Site: position = -87 score = 4.38878 sequence = GAGTATTGAATTGTTTACGA Gene: CKO_03376: Predicted tyrosine transporter, COG2814 family |
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -60 score = 4.41759 sequence = TAGTGATTTTTACTTTACAC Site: position = -82 score = 3.90884 sequence = GTGTGCCGTTTTATTTACGA Gene: KPN_00010: Predicted tyrosine transporter, COG2814 family |
*
Enterobacter sp. 638 Site: position = -37 score = 4.44249 sequence = CTGTAAAATTAAATCAACAA Site: position = -60 score = 4.8874 sequence = TAGTAATTTTTTCTTTACGA Gene: Ent638_0572: Predicted tyrosine transporter, COG2814 family |
|
*
Yersinia pestis KIM Site: position = -68 score = 4.23904 sequence = TAGTCATGTTAACTTTACAA Gene: y3709: Predicted tyrosine transporter, COG2814 family |
*
Serratia proteamaculans 568 Site: position = -65 score = 3.97913 sequence = TAGTAAGGATTCGTTTACAG Site: position = -87 score = 3.65227 sequence = GTGTGAAAATAATTTGCCGT Gene: Spro_0690: Predicted tyrosine transporter, COG2814 family |
*
Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -68 score = 5.0033 sequence = TAGTAATTTATACTTTACAC Site: position = -90 score = 3.99158 sequence = GTGTATAAAAATTTTGCCGA Gene: ECA3884: Predicted tyrosine transporter, COG2814 family |
*
Edwardsiella tarda EIB202 Site: position = -66 score = 3.65104 sequence = TTATATTTCTATTTTTGCAA Gene: ETAE_0574: Predicted tyrosine transporter, COG2814 family |
|
|
Predicted tyrosine transporter, COG2814 family |
| CRON 4. | |||||||||||||
| tyrP |
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -110 score = 5.56051 sequence = TTGTACATTTATATTTACAC Gene: b1907: Tyrosine-specific transport protein |
*
Salmonella typhimurium LT2 Site: position = -110 score = 5.1203 sequence = CTGTAAATTTTACAGTACAC Gene: STM1937: Tyrosine-specific transport protein |
*
Citrobacter koseri ATCC BAA-895 Site: position = -83 score = 4.6082 sequence = TCGTAAACAATGGTATACAC Gene: CKO_01040: Tyrosine-specific transport protein |
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -110 score = 5.25081 sequence = ATGTAAACATTTCATTACAC Gene: KPN_02404: Tyrosine-specific transport protein |
*
Enterobacter sp. 638 Site: position = -44 score = 5.13028 sequence = TCGTAAACATTTCATTACAC Gene: Ent638_2489: Tyrosine-specific transport protein |
|
*
Yersinia pestis KIM Site: position = -266 score = 5.4479 sequence = tcGTAAAcTatAATTTACAC Gene: y2979: Tyrosine-specific transport protein |
*
Serratia proteamaculans 568 Site: position = -124 score = 4.75279 sequence = GCGTAAACTTAAGTTAACAC Gene: Spro_3276: Tyrosine-specific transport protein |
*
Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -235 score = 5.77953 sequence = GTGTAAATATAAAATTACAC Gene: ECA1218: Tyrosine-specific transport protein |
*
Edwardsiella tarda EIB202 Site: position = -106 score = 5.13454 sequence = GTGTAAATGAATAATTACAT Gene: ETAE_2350: Tyrosine-specific transport protein |
*
Proteus mirabilis HI4320 Site: position = -106 score = 5.28136 sequence = TTGTAAACAAAACATTACAC Site: position = -83 score = 4.69202 sequence = TCGTAATTAAAATTTGACAG Gene: PMI1738: Tyrosine-specific transport protein |
*
Photorhabdus luminescens subsp. laumondii TTO1 Site: position = -110 score = 5.68159 sequence = TTGTAATTATTTATTTACAC Gene: plu3066: Tyrosine-specific transport protein |
Tyrosine-specific transport protein |
| CRON 5. | |||||||||||||
| aroL |
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -182 score = 5.61055 sequence = ATGTAATTTATTATTTACAC Site: position = -106 score = 4.99756 sequence = GTGGAATTTTTTCTTTACAA Gene: b0388: Shikimate kinase III (EC 2.7.1.71) |
*
Salmonella typhimurium LT2 Site: position = -181 score = 5.40079 sequence = ATGTAATGAAAAATTTACAG Site: position = -107 score = 5.75492 sequence = GTGTAAATTATTATTTACAT Gene: STM0388: Shikimate kinase III (EC 2.7.1.71) |
*
Citrobacter koseri ATCC BAA-895 Site: position = -163 score = 4.967 sequence = GTGGAATGATTTATTTACAT Site: position = -238 score = 5.36458 sequence = ATGTAATGTTATTTTTACAC Gene: CKO_02783: Shikimate kinase III (EC 2.7.1.71) |
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -165 score = 4.63447 sequence = ATGCAATGATAAGTTTACAT Site: position = -101 score = 5.31752 sequence = GTGTAATTTTTTCTTTACGT Gene: KPN_00332: Shikimate kinase III (EC 2.7.1.71) |
*
Enterobacter sp. 638 Site: position = -108 score = 4.90653 sequence = CTGTAATCCAATTTTTACAA Site: position = -182 score = 4.53481 sequence = ATGCAATGATTTCTTTACAG Gene: Ent638_0859: Shikimate kinase III (EC 2.7.1.71) |
*
Erwinia amylovora ATCC 49946 Site: position = -126 score = 4.52112 sequence = CTGTAAATAAAACGTTACTG Gene: EAM_0932: Shikimate kinase III (EC 2.7.1.71) |
*
Yersinia pestis KIM Site: position = -174 score = 5.03708 sequence = GTGTATTATTAATTTTACGT Gene: y0972: Shikimate kinase III (EC 2.7.1.71) |
*
Serratia proteamaculans 568 Site: position = -122 score = 4.86166 sequence = TCGTAAATATTGAAATACAG Gene: Spro_1018: Shikimate kinase III (EC 2.7.1.71) |
Gene: ECA1103: Shikimate kinase III (EC 2.7.1.71) |
|
*
Proteus mirabilis HI4320 Site: position = -57 score = 5.50553 sequence = TTGTAAATTTTAGATTACAC Gene: PMI0371: Shikimate kinase III (EC 2.7.1.71) |
*
Photorhabdus luminescens subsp. laumondii TTO1 Site: position = -69 score = 4.0764 sequence = ATGTAAATTTCTGGTTACTA Gene: plu1245: Shikimate kinase III (EC 2.7.1.71) |
Shikimate kinase III (EC 2.7.1.71) |
| yaiA |
Gene: b0389: hypothetical protein |
Gene: STM0389: hypothetical protein |
Gene: CKO_02782: hypothetical protein |
Gene: KPN_00333: hypothetical protein |
Gene: Ent638_0860: hypothetical protein |
|
|
|
|
|
|
|
hypothetical protein |
| aroM |
Gene: b0390: AroM family protein |
Gene: STM0390: AroM family protein |
Gene: CKO_02781: AroM family protein |
Gene: KPN_00334: AroM family protein |
Gene: Ent638_0861: AroM family protein |
Gene: EAM_0937: AroM family protein |
|
Gene: Spro_1025: AroM family protein |
|
|
|
|
AroM family protein |
| CRON 6. | |||||||||||||
| mtr |
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -129 score = 5.3368 sequence = CTGTAAAATAATATATACAG Gene: b3161: Tryptophan-specific transport protein |
*
Salmonella typhimurium LT2 Site: position = -129 score = 5.20516 sequence = GCGTAAAGTAAAATATACAG Gene: STM3279: Tryptophan-specific transport protein |
*
Citrobacter koseri ATCC BAA-895 Site: position = -129 score = 5.14779 sequence = CCGTAAAGTAAAATATACAG Gene: CKO_04558: Tryptophan-specific transport protein |
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -128 score = 4.92266 sequence = GCGTAAACTAAATAATACAG Gene: KPN_03569: Tryptophan-specific transport protein |
*
Enterobacter sp. 638 Site: position = -128 score = 5.19473 sequence = GCGTAAAGTAATATATACAG Gene: Ent638_3598: Tryptophan-specific transport protein |
Gene: EAM_1150: Tryptophan-specific transport protein |
Gene: y2900: Tryptophan-specific transport protein |
Gene: Spro_3236: Tryptophan-specific transport protein |
Gene: ECA0872: Tryptophan-specific transport protein |
Gene: ETAE_2287: Tryptophan-specific transport protein |
Gene: PMI0836: Tryptophan-specific transport protein |
Gene: plu2860: Tryptophan-specific transport protein |
Tryptophan-specific transport protein |
| CRON 7. | |||||||||||||
| aroF |
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -165 score = 5.39672 sequence = GTGTAAATTTATCTATACAG Site: position = -113 score = 5.35852 sequence = GTGTAAATAAAAATGTACGA Site: position = -90 score = 4.03726 sequence = ATGGATTGAAAACTTTACTT Gene: b2601: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54) |
*
Salmonella typhimurium LT2 Site: position = -164 score = 4.4821 sequence = GTGTAAAGTTTTTGATACGA Site: position = -113 score = 5.31738 sequence = GTGTAAAGTTTATTTTACGT Site: position = -90 score = 4.02682 sequence = ATGGATTGAAATCTTTACTT Gene: STM2670: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54) |
*
Citrobacter koseri ATCC BAA-895 Site: position = -89 score = 4.00067 sequence = GTGGATTGAAATCTTTACCG Site: position = -165 score = 5.31223 sequence = ATGTAAATTTTTATGTACGA Site: position = -112 score = 5.41495 sequence = ATGTAAAGTAAAATTTACGG Gene: CKO_03921: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54) |
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -90 score = 3.96548 sequence = ATGGATTGAATTCTTTACTT Site: position = -166 score = 4.93463 sequence = GTGTAAATATTGTTATACGC Site: position = -113 score = 5.67497 sequence = GTGTAAATTAAAATTTACGG Gene: KPN_02923: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54) |
*
Enterobacter sp. 638 Site: position = -112 score = 5.67497 sequence = GTGTAAATTAAAATTTACGG Site: position = -89 score = 4.03587 sequence = TTGGATTGAAATCTTTACTG Site: position = -165 score = 5.35843 sequence = CTGTAATTTTATGTTTACGA Gene: Ent638_3080: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54) |
*
Erwinia amylovora ATCC 49946 Site: position = -73 score = 3.99934 sequence = ATGTACTCATTATGGTACAG Site: position = -202 score = 5.32325 sequence = CTGTAATCTTTTATTTACGC Site: position = -106 score = 4.14326 sequence = CTGGTAATTAATGTGTACAC Gene: EAM_2621: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54) |
*
Yersinia pestis KIM Site: position = -114 score = 5.23135 sequence = TAGTAATTATTTATTTACAA Site: position = -92 score = 4.46133 sequence = ATGGATTGAAAACTTTACAT Gene: y0903: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54) |
*
Serratia proteamaculans 568 Site: position = -99 score = 4.55454 sequence = TCGGATTTAAAACTTTACAT Site: position = -122 score = 5.14921 sequence = TGGTAATTTTTTATTTACAG Gene: Spro_0879: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54) |
*
Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -133 score = 4.5592 sequence = GTGGATTTAAATCTTTACGG Site: position = -156 score = 5.20658 sequence = TGGTAATTTTTTATTTACAC Gene: ECA3352: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54) |
*
Edwardsiella tarda EIB202 Site: position = -129 score = 4.64097 sequence = GTGTAAAGATGAATGTACGA Site: position = -95 score = 4.04299 sequence = ATGGATTGAAAAGTTTACTG Site: position = -117 score = 4.59175 sequence = ATGTACGATATTGTTTACAT Gene: ETAE_2837: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54) |
*
Proteus mirabilis HI4320 Site: position = -244 score = 5.57766 sequence = GTGTAAAATTAAAATTACAG Site: position = -127 score = 5.16215 sequence = ATGTAAACATATGATTACGA Site: position = -85 score = 4.4509 sequence = ATGGATTGATTTCTTTACAT Gene: PMI0387: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54) |
*
Photorhabdus luminescens subsp. laumondii TTO1 Site: position = -98 score = 4.29958 sequence = TTGGATTGTATTCTTTACGA Site: position = -140 score = 5.52075 sequence = TTGTAAACAATAATTTACAG Gene: plu1262: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54) |
2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54) |
| tyrA |
Gene: b2600: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43) |
Gene: STM2669: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43) |
Gene: CKO_03920: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43) |
Gene: KPN_02922: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43) |
Gene: Ent638_3079: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43) |
Gene: EAM_2620: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43) |
Gene: y0904: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43) |
Gene: Spro_0880: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43) |
Gene: ECA3351: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43) |
Gene: ETAE_2836: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43) |
Gene: PMI0388: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43) |
Gene: plu1263: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43) |
Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43) |
| CRON 8. | |||||||||||||
| aroP |
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -89 score = 5.02736 sequence = ATGTAAACAAATTAATACAA Gene: b0112: Aromatic amino acid transport protein AroP |
*
Salmonella typhimurium LT2 Site: position = -108 score = 5.1856 sequence = TTGTAAATAAATCAATACAA Gene: STM0150: Aromatic amino acid transport protein AroP |
*
Citrobacter koseri ATCC BAA-895 Site: position = -87 score = 4.99435 sequence = GcGTAAAcaTAttaaTACAa Gene: CKO_03262: Aromatic amino acid transport protein AroP |
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -192 score = 4.79606 sequence = CCGTAAACAAAACAATACAG Gene: KPN_00116: Aromatic amino acid transport protein AroP |
*
Enterobacter sp. 638 Site: position = -87 score = 4.40474 sequence = CCGTAACGAAATAAATACAT Site: position = -64 score = 4.54299 sequence = ATGGAATTTCATAATTACAC Gene: Ent638_0658: Aromatic amino acid transport protein AroP |
*
Erwinia amylovora ATCC 49946 Site: position = -187 score = 4.36706 sequence = GCGTAAAGTTTCCAATACAC Gene: EAM_0745: Aromatic amino acid transport protein AroP |
*
Yersinia pestis KIM Site: position = -234 score = 5.32017 sequence = GTGTAATTAAATGATTACAT Gene: y0765: Aromatic amino acid transport protein AroP |
*
Serratia proteamaculans 568 Site: position = -80 score = 4.4033 sequence = CCGTAAATAAAACAAAACAC Gene: Spro_4013: Aromatic amino acid transport protein AroP |
*
Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -93 score = 5.42658 sequence = CCGTAAAAATAAAATTACAC Gene: ECA3791: Aromatic amino acid transport protein AroP |
*
Edwardsiella tarda EIB202 Site: position = -91 score = 5.4115 sequence = ATGTAAAAATAAAATTACGA Gene: ETAE_0657: Aromatic amino acid transport protein AroP |
*
Proteus mirabilis HI4320 Site: position = -51 score = 5.12255 sequence = TCGTAAACATTGATTTACAC Gene: PMI1596: Aromatic amino acid transport protein AroP |
Gene: plu2785: Aromatic amino acid transport protein AroP |
Aromatic amino acid transport protein AroP |
| CRON 9. | |||||||||||||
| ompF |
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -75 score = 4.96012 sequence = CCGTAAATTTTTATTGACAG Gene: b0929: outer membrane porin F |
*
Salmonella typhimurium LT2 Site: position = -77 score = 4.74639 sequence = CTGTAAAGTTTTATTGACGG Gene: STM0999: outer membrane porin F |
*
Citrobacter koseri ATCC BAA-895 Site: position = -76 score = 4.96012 sequence = ccGTAAATTTttATTgACAg Gene: CKO_02137: outer membrane porin F |
|
*
Enterobacter sp. 638 Site: position = -77 score = 4.46896 sequence = CCGGAAATATTTATTGACAG Gene: Ent638_1448: outer membrane porin F |
|
|
|
|
|
|
|
outer membrane porin F |
| CRON 10. | |||||||||||||
| tpl |
|
|
*
Citrobacter koseri ATCC BAA-895 Site: position = -307 score = 4.34376 sequence = CTGGAAAGTTAAGTTTTCAC Gene: CKO_03467: Tyrosine phenol-lyase (EC 4.1.99.2) |
|
|
|
|
|
|
|
|
|
Tyrosine phenol-lyase (EC 4.1.99.2) |
| CRON 11. | |||||||||||||
| ipdC |
|
*
Salmonella typhimurium LT2 Site: position = -100 score = 4.53897 sequence = CTGTAAACATTGTTTTCCAG Gene: STM2405: Indole-3-pyruvate decarboxylase (EC 4.1.1.74) |
*
Citrobacter koseri ATCC BAA-895 Site: position = -101 score = 3.80347 sequence = CTGTAAATCCTGCTTTCCAC Gene: CKO_00409: Indole-3-pyruvate decarboxylase (EC 4.1.1.74) |
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -97 score = 4.98754 sequence = GCGTAATTATTGCTTTACAC Gene: KPN_02740: Indole-3-pyruvate decarboxylase (EC 4.1.1.74) |
|
Gene: EAM_2375: Indole-3-pyruvate decarboxylase (EC 4.1.1.74) |
|
Gene: Spro_3412: Indole-3-pyruvate decarboxylase (EC 4.1.1.74) |
|
|
|
|
Indole-3-pyruvate decarboxylase (EC 4.1.1.74) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |