Regulon of TyrR in Enterobacter sp. 638

Properties
Regulator type:	Transcription factor
TF locus tag:	Ent638_2152
Regulator family:	TyrR
Regulation mode:	activator (repressor)
Biological process:	Aromatic amino acid metabolism
Effector:	Tyrosine; Phenylalanine
Regulog:	TyrR - Enterobacteriales
Statistics of regulated genes:
- Genes	11
- Operons	8
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 106 sites [see more]

Member of regulog collections

By trascription factor - TyrR
By taxonomy - Enterobacteriales
By TF family - TyrR
By effector - Tyrosine
By effector - Phenylalanine
By pathway - Aromatic amino acid metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -86 Score: 3.7 Sequence: CTGTCAATATCTGTTGACAG Locus tag: Ent638_2152 Name: tyrR Funciton: Transcriptional regulator of aromatic amino acid biosynthesis
	Ent638_2152	tyrR	Transcriptional regulator of aromatic amino acid biosynthesis
Position: -128 Score: 5.2 Sequence: GCGTAAAGTAATATATACAG Locus tag: Ent638_3598 Name: mtr Funciton: Tryptophan-specific transport protein
	Ent638_3598	mtr	Tryptophan-specific transport protein
Position: -182 Score: 4.5 Sequence: ATGCAATGATTTCTTTACAG Position: -108 Score: 4.9 Sequence: CTGTAATCCAATTTTTACAA Locus tag: Ent638_0859 Name: aroL Funciton: Shikimate kinase III (EC 2.7.1.71) Locus tag: Ent638_0860 Name: yaiA Funciton: hypothetical protein Locus tag: Ent638_0861 Name: aroM Funciton: AroM family protein
	Ent638_0859	aroL	Shikimate kinase III (EC 2.7.1.71)
	Ent638_0860	yaiA	hypothetical protein
	Ent638_0861	aroM	AroM family protein
Position: -165 Score: 5.4 Sequence: CTGTAATTTTATGTTTACGA Position: -112 Score: 5.7 Sequence: GTGTAAATTAAAATTTACGG Position: -89 Score: 4 Sequence: TTGGATTGAAATCTTTACTG Locus tag: Ent638_3080 Name: aroF Funciton: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54) Locus tag: Ent638_3079 Name: tyrA Funciton: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
	Ent638_3080	aroF	2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
	Ent638_3079	tyrA	Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
Position: -77 Score: 4.5 Sequence: CCGGAAATATTTATTGACAG Locus tag: Ent638_1448 Name: ompF Funciton: outer membrane porin F
	Ent638_1448	ompF	outer membrane porin F
Position: -44 Score: 5.1 Sequence: TCGTAAACATTTCATTACAC Locus tag: Ent638_2489 Name: tyrP Funciton: Tyrosine-specific transport protein
	Ent638_2489	tyrP	Tyrosine-specific transport protein
Position: -60 Score: 4.9 Sequence: TAGTAATTTTTTCTTTACGA Position: -37 Score: 4.4 Sequence: CTGTAAAATTAAATCAACAA Locus tag: Ent638_0572 Name: COG2814 Funciton: Predicted tyrosine transporter, COG2814 family
	Ent638_0572	COG2814	Predicted tyrosine transporter, COG2814 family
Position: -87 Score: 4.4 Sequence: CCGTAACGAAATAAATACAT Position: -64 Score: 4.5 Sequence: ATGGAATTTCATAATTACAC Locus tag: Ent638_0658 Name: aroP Funciton: Aromatic amino acid transport protein AroP
	Ent638_0658	aroP	Aromatic amino acid transport protein AroP

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD