Regulon of TyrR in Serratia proteamaculans 568

Properties
Regulator type:	Transcription factor
TF locus tag:	Spro_2617
Regulator family:	TyrR
Regulation mode:	activator (repressor)
Biological process:	Aromatic amino acid metabolism
Effector:	Tyrosine; Phenylalanine
Regulog:	TyrR - Enterobacteriales
Statistics of regulated genes:
- Genes	7
- Operons	6
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 106 sites [see more]

Member of regulog collections

By trascription factor - TyrR
By taxonomy - Enterobacteriales
By TF family - TyrR
By effector - Tyrosine
By effector - Phenylalanine
By pathway - Aromatic amino acid metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -122 Score: 4.9 Sequence: TCGTAAATATTGAAATACAG Locus tag: Spro_1018 Name: aroL Funciton: Shikimate kinase III (EC 2.7.1.71)
	Spro_1018	aroL	Shikimate kinase III (EC 2.7.1.71)
Position: -98 Score: 3.6 Sequence: CTGTCAACTTTTGCTGACAG Locus tag: Spro_2617 Name: tyrR Funciton: Transcriptional regulator of aromatic amino acid biosynthesis
	Spro_2617	tyrR	Transcriptional regulator of aromatic amino acid biosynthesis
Position: -122 Score: 5.1 Sequence: TGGTAATTTTTTATTTACAG Position: -99 Score: 4.6 Sequence: TCGGATTTAAAACTTTACAT Locus tag: Spro_0879 Name: aroF Funciton: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54) Locus tag: Spro_0880 Name: tyrA Funciton: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
	Spro_0879	aroF	2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
	Spro_0880	tyrA	Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
Position: -87 Score: 3.7 Sequence: GTGTGAAAATAATTTGCCGT Position: -65 Score: 4 Sequence: TAGTAAGGATTCGTTTACAG Locus tag: Spro_0690 Name: COG2814 Funciton: Predicted tyrosine transporter, COG2814 family
	Spro_0690	COG2814	Predicted tyrosine transporter, COG2814 family
Position: -124 Score: 4.8 Sequence: GCGTAAACTTAAGTTAACAC Locus tag: Spro_3276 Name: tyrP Funciton: Tyrosine-specific transport protein
	Spro_3276	tyrP	Tyrosine-specific transport protein
Position: -80 Score: 4.4 Sequence: CCGTAAATAAAACAAAACAC Locus tag: Spro_4013 Name: aroP Funciton: Aromatic amino acid transport protein AroP
	Spro_4013	aroP	Aromatic amino acid transport protein AroP

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD