Regulon of TyrR in Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Properties
Regulator type:	Transcription factor
TF locus tag:	KPN_01305
Regulator family:	TyrR
Regulation mode:	activator (repressor)
Biological process:	Aromatic amino acid metabolism
Effector:	Tyrosine; Phenylalanine
Regulog:	TyrR - Enterobacteriales
Statistics of regulated genes:
- Genes	11
- Operons	8
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 106 sites [see more]

Member of regulog collections

By trascription factor - TyrR
By taxonomy - Enterobacteriales
By TF family - TyrR
By effector - Tyrosine
By effector - Phenylalanine
By pathway - Aromatic amino acid metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -97 Score: 5 Sequence: GCGTAATTATTGCTTTACAC Locus tag: KPN_02740 Name: ipdC Funciton: Indole-3-pyruvate decarboxylase (EC 4.1.1.74)
	KPN_02740	ipdC	Indole-3-pyruvate decarboxylase (EC 4.1.1.74)
Position: -90 Score: 4.2 Sequence: CTGTCAATAATTGTTGACAG Locus tag: KPN_01305 Name: tyrR Funciton: Transcriptional regulator of aromatic amino acid biosynthesis
	KPN_01305	tyrR	Transcriptional regulator of aromatic amino acid biosynthesis
Position: -166 Score: 4.9 Sequence: GTGTAAATATTGTTATACGC Position: -113 Score: 5.7 Sequence: GTGTAAATTAAAATTTACGG Position: -90 Score: 4 Sequence: ATGGATTGAATTCTTTACTT Locus tag: KPN_02923 Name: aroF Funciton: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54) Locus tag: KPN_02922 Name: tyrA Funciton: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
	KPN_02923	aroF	2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
	KPN_02922	tyrA	Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
Position: -82 Score: 3.9 Sequence: GTGTGCCGTTTTATTTACGA Position: -60 Score: 4.4 Sequence: TAGTGATTTTTACTTTACAC Locus tag: KPN_00010 Name: COG2814 Funciton: Predicted tyrosine transporter, COG2814 family
	KPN_00010	COG2814	Predicted tyrosine transporter, COG2814 family
Position: -110 Score: 5.3 Sequence: ATGTAAACATTTCATTACAC Locus tag: KPN_02404 Name: tyrP Funciton: Tyrosine-specific transport protein
	KPN_02404	tyrP	Tyrosine-specific transport protein
Position: -192 Score: 4.8 Sequence: CCGTAAACAAAACAATACAG Locus tag: KPN_00116 Name: aroP Funciton: Aromatic amino acid transport protein AroP
	KPN_00116	aroP	Aromatic amino acid transport protein AroP
Position: -165 Score: 4.6 Sequence: ATGCAATGATAAGTTTACAT Position: -101 Score: 5.3 Sequence: GTGTAATTTTTTCTTTACGT Locus tag: KPN_00332 Name: aroL Funciton: Shikimate kinase III (EC 2.7.1.71) Locus tag: KPN_00333 Name: yaiA Funciton: hypothetical protein Locus tag: KPN_00334 Name: aroM Funciton: AroM family protein
	KPN_00332	aroL	Shikimate kinase III (EC 2.7.1.71)
	KPN_00333	yaiA	hypothetical protein
	KPN_00334	aroM	AroM family protein
Position: -128 Score: 4.9 Sequence: GCGTAAACTAAATAATACAG Locus tag: KPN_03569 Name: mtr Funciton: Tryptophan-specific transport protein
	KPN_03569	mtr	Tryptophan-specific transport protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD