Regulon of TyrR in Escherichia coli str. K-12 substr. MG1655

Properties
Regulator type:	Transcription factor
TF locus tag:	b1323
Regulator family:	TyrR
Regulation mode:	activator (repressor)
Biological process:	Aromatic amino acid metabolism
Effector:	Tyrosine; Phenylalanine
Regulog:	TyrR - Enterobacteriales
Statistics of regulated genes:
- Genes	11
- Operons	8
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 106 sites [see more]

Member of regulog collections

By trascription factor - TyrR
By taxonomy - Enterobacteriales
By TF family - TyrR
By effector - Tyrosine
By effector - Phenylalanine
By pathway - Aromatic amino acid metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -89 Score: 3.7 Sequence: GTGTCAATGATTGTTGACAG Locus tag: b1323 Name: tyrR Funciton: Transcriptional regulator of aromatic amino acid biosynthesis
	b1323	tyrR	Transcriptional regulator of aromatic amino acid biosynthesis
Position: -129 Score: 5.3 Sequence: CTGTAAAATAATATATACAG Locus tag: b3161 Name: mtr Funciton: Tryptophan-specific transport protein
	b3161	mtr	Tryptophan-specific transport protein
Position: -182 Score: 4.5 Sequence: ACGTAAATCACACTTTACAG Locus tag: b0048 Name: folA Funciton: Dihydrofolate reductase (EC 1.5.1.3)
	b0048	folA	Dihydrofolate reductase (EC 1.5.1.3)
Position: -75 Score: 5 Sequence: CCGTAAATTTTTATTGACAG Locus tag: b0929 Name: ompF Funciton: outer membrane porin F
	b0929	ompF	outer membrane porin F
Position: -110 Score: 5.6 Sequence: TTGTACATTTATATTTACAC Locus tag: b1907 Name: tyrP Funciton: Tyrosine-specific transport protein
	b1907	tyrP	Tyrosine-specific transport protein
Position: -165 Score: 5.4 Sequence: GTGTAAATTTATCTATACAG Position: -113 Score: 5.4 Sequence: GTGTAAATAAAAATGTACGA Position: -90 Score: 4 Sequence: ATGGATTGAAAACTTTACTT Locus tag: b2601 Name: aroF Funciton: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54) Locus tag: b2600 Name: tyrA Funciton: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
	b2601	aroF	2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
	b2600	tyrA	Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
Position: -89 Score: 5 Sequence: ATGTAAACAAATTAATACAA Locus tag: b0112 Name: aroP Funciton: Aromatic amino acid transport protein AroP
	b0112	aroP	Aromatic amino acid transport protein AroP
Position: -182 Score: 5.6 Sequence: ATGTAATTTATTATTTACAC Position: -106 Score: 5 Sequence: GTGGAATTTTTTCTTTACAA Locus tag: b0388 Name: aroL Funciton: Shikimate kinase III (EC 2.7.1.71) Locus tag: b0389 Name: yaiA Funciton: hypothetical protein Locus tag: b0390 Name: aroM Funciton: AroM family protein
	b0388	aroL	Shikimate kinase III (EC 2.7.1.71)
	b0389	yaiA	hypothetical protein
	b0390	aroM	AroM family protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD