Regulon of TyrR in Erwinia carotovora subsp. atroseptica SCRI1043

Properties
Regulator type:	Transcription factor
TF locus tag:	ECA1989
Regulator family:	TyrR
Regulation mode:	activator (repressor)
Biological process:	Aromatic amino acid metabolism
Effector:	Tyrosine; Phenylalanine
Regulog:	TyrR - Enterobacteriales
Statistics of regulated genes:
- Genes	5
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 106 sites [see more]

Member of regulog collections

By trascription factor - TyrR
By taxonomy - Enterobacteriales
By TF family - TyrR
By effector - Tyrosine
By effector - Phenylalanine
By pathway - Aromatic amino acid metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -90 Score: 4 Sequence: GTGTATAAAAATTTTGCCGA Position: -68 Score: 5 Sequence: TAGTAATTTATACTTTACAC Locus tag: ECA3884 Name: COG2814 Funciton: Predicted tyrosine transporter, COG2814 family
	ECA3884	COG2814	Predicted tyrosine transporter, COG2814 family
Position: -156 Score: 5.2 Sequence: TGGTAATTTTTTATTTACAC Position: -133 Score: 4.6 Sequence: GTGGATTTAAATCTTTACGG Locus tag: ECA3352 Name: aroF Funciton: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54) Locus tag: ECA3351 Name: tyrA Funciton: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
	ECA3352	aroF	2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
	ECA3351	tyrA	Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
Position: -235 Score: 5.8 Sequence: GTGTAAATATAAAATTACAC Locus tag: ECA1218 Name: tyrP Funciton: Tyrosine-specific transport protein
	ECA1218	tyrP	Tyrosine-specific transport protein
Position: -93 Score: 5.4 Sequence: CCGTAAAAATAAAATTACAC Locus tag: ECA3791 Name: aroP Funciton: Aromatic amino acid transport protein AroP
	ECA3791	aroP	Aromatic amino acid transport protein AroP

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD