Regulon of TyrR in Salmonella typhimurium LT2

Properties
Regulator type:	Transcription factor
TF locus tag:	STM4005
Regulator family:	TyrR
Regulation mode:	activator (repressor)
Biological process:	Aromatic amino acid metabolism
Effector:	Tyrosine; Phenylalanine
Regulog:	TyrR - Enterobacteriales
Statistics of regulated genes:
- Genes	11
- Operons	8
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 106 sites [see more]

Member of regulog collections

By trascription factor - TyrR
By taxonomy - Enterobacteriales
By TF family - TyrR
By effector - Tyrosine
By effector - Phenylalanine
By pathway - Aromatic amino acid metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -100 Score: 4.5 Sequence: CTGTAAACATTGTTTTCCAG Locus tag: STM2405 Name: ipdC Funciton: Indole-3-pyruvate decarboxylase (EC 4.1.1.74)
	STM2405	ipdC	Indole-3-pyruvate decarboxylase (EC 4.1.1.74)
Position: -89 Score: 4.2 Sequence: CTGTCAATATTTGTTGACAG Locus tag: STM1683 Name: tyrR Funciton: Transcriptional regulator of aromatic amino acid biosynthesis
	STM1683	tyrR	Transcriptional regulator of aromatic amino acid biosynthesis
Position: -129 Score: 5.2 Sequence: GCGTAAAGTAAAATATACAG Locus tag: STM3279 Name: mtr Funciton: Tryptophan-specific transport protein
	STM3279	mtr	Tryptophan-specific transport protein
Position: -181 Score: 5.4 Sequence: ATGTAATGAAAAATTTACAG Position: -107 Score: 5.8 Sequence: GTGTAAATTATTATTTACAT Locus tag: STM0388 Name: aroL Funciton: Shikimate kinase III (EC 2.7.1.71) Locus tag: STM0389 Name: yaiA Funciton: hypothetical protein Locus tag: STM0390 Name: aroM Funciton: AroM family protein
	STM0388	aroL	Shikimate kinase III (EC 2.7.1.71)
	STM0389	yaiA	hypothetical protein
	STM0390	aroM	AroM family protein
Position: -164 Score: 4.5 Sequence: GTGTAAAGTTTTTGATACGA Position: -113 Score: 5.3 Sequence: GTGTAAAGTTTATTTTACGT Position: -90 Score: 4 Sequence: ATGGATTGAAATCTTTACTT Locus tag: STM2670 Name: aroF Funciton: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54) Locus tag: STM2669 Name: tyrA Funciton: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
	STM2670	aroF	2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
	STM2669	tyrA	Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
Position: -77 Score: 4.7 Sequence: CTGTAAAGTTTTATTGACGG Locus tag: STM0999 Name: ompF Funciton: outer membrane porin F
	STM0999	ompF	outer membrane porin F
Position: -110 Score: 5.1 Sequence: CTGTAAATTTTACAGTACAC Locus tag: STM1937 Name: tyrP Funciton: Tyrosine-specific transport protein
	STM1937	tyrP	Tyrosine-specific transport protein
Position: -108 Score: 5.2 Sequence: TTGTAAATAAATCAATACAA Locus tag: STM0150 Name: aroP Funciton: Aromatic amino acid transport protein AroP
	STM0150	aroP	Aromatic amino acid transport protein AroP

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD