Regulog XylR - Bacillales
| Regulator type: | Transcription factor |
| Regulator family: | ROK |
| Regulation mode: | repressor |
| Biological process: | Xylose utilization |
| Effector: | Xylose |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By trascription factor - XylR
- By taxonomy - Bacillales
- By TF family - ROK
- By effector - Xylose
- By pathway - Xylose utilization
| Genome | Genes | Operons |
|---|---|---|
| Bacillus subtilis subsp. subtilis str. 168 | 5 | 3 |
| Bacillus amyloliquefaciens FZB42 | 5 | 3 |
| Bacillus pumilus SAFR-032 | 5 | 3 |
| Bacillus licheniformis DSM 13 | 10 | 4 |
| Anoxybacillus flavithermus WK1 | ||
| Geobacillus kaustophilus HTA426 | 8 | 4 |
| Bacillus cereus ATCC 14579 | ||
| Bacillus halodurans C-125 | 12 | 4 |
| Bacillus clausii KSM-K16 | 6 | 2 |
| Oceanobacillus iheyensis HTE831 | 7 | 3 |
| Paenibacillus sp. JDR-2 | 3 | 2 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| xynA |
|
|
|
|
|
|
|
*
Bacillus halodurans C-125 Site: position = -192 score = 5.84087 sequence = AGTTTGTTCACTGGATCAACTAAGT Gene: BH2120: Endo-1,4-beta-xylanase A precursor (EC 3.2.1.8) |
|
|
Gene: Pjdr2_4244: Endo-1,4-beta-xylanase A precursor (EC 3.2.1.8) |
Endo-1,4-beta-xylanase A precursor (EC 3.2.1.8) |
| CRON 2. | ||||||||||||
| xylF |
|
|
|
|
|
*
Geobacillus kaustophilus HTA426 Site: position = -89 score = 5.56838 sequence = ACTTTGTTTGTATTATGGACAAACA Gene: GK1881: D-xylose ABC transporter (substrate-binding protein) |
|
|
|
|
Gene: Pjdr2_0976: D-xylose ABC transporter (substrate-binding protein) |
D-xylose ABC transporter (substrate-binding protein) |
| CRON 3. | ||||||||||||
| BH3678 |
|
|
|
|
|
|
|
*
Bacillus halodurans C-125 Site: position = -165 score = 6.14666 sequence = ACTTTGTTTAATGGTAAAACAAAGT Gene: BH3678: Two-component sensor histidine kinase |
|
|
Gene: Pjdr2_0726: Two-component sensor histidine kinase |
Two-component sensor histidine kinase |
| BH3679 |
|
|
|
|
|
|
|
Gene: BH3679: Two component transcriptional regulator, AraC family |
|
|
Gene: Pjdr2_0727: Two component transcriptional regulator, AraC family |
Two component transcriptional regulator, AraC family |
| BH3680 |
|
|
|
|
|
|
|
Gene: BH3680: Predicted beta-xyloside ABC transporter, substrate-binding component |
|
*
Oceanobacillus iheyensis HTE831 Site: position = -90 score = 5.81055 sequence = ACTTTGTTTAACCGGTAGACAAACA Gene: OB3123: Predicted beta-xyloside ABC transporter, substrate-binding component |
Gene: Pjdr2_0728: Predicted beta-xyloside ABC transporter, substrate-binding component |
Predicted beta-xyloside ABC transporter, substrate-binding component |
| BH3681 |
|
|
|
|
|
|
|
Gene: BH3681: Predicted beta-xyloside ABC transporter, permease component |
|
Gene: OB3122: Predicted beta-xyloside ABC transporter, permease component |
Gene: Pjdr2_0729: Predicted beta-xyloside ABC transporter, permease component |
Predicted beta-xyloside ABC transporter, permease component |
| BH3682 |
|
|
|
|
|
|
|
Gene: BH3682: Predicted beta-xyloside ABC transporter, ATP-binding component |
|
Gene: OB3121: Predicted beta-xyloside ABC transporter, ATP-binding component |
Gene: Pjdr2_0730: Predicted beta-xyloside ABC transporter, ATP-binding component |
Predicted beta-xyloside ABC transporter, ATP-binding component |
| xynB |
|
|
|
|
|
|
|
Gene: BH3683: Beta-xylosidase (EC 3.2.1.37) |
|
|
|
Beta-xylosidase (EC 3.2.1.37) |
| BH3684 |
|
|
|
|
|
|
|
Gene: BH3684: Putative permease |
|
|
|
Putative permease |
| CRON 4. | ||||||||||||
| gunA |
|
|
Gene: BPUM_1558: Endoglucanase 4 precursor (EC 3.2.1.4) |
*
Bacillus licheniformis DSM 13 Site: position = -202 score = 6.30424 sequence = ACTTAGTTTATTGAACAAATAAACT Gene: BLi01880: Endoglucanase 4 precursor (EC 3.2.1.4) |
|
|
|
|
|
|
|
Endoglucanase 4 precursor (EC 3.2.1.4) |
| gunB |
|
|
Gene: BPUM_1559: endoglucanase A (Endo-1,4-beta-glucanase A)(Cellulase A)( EC 3.2.1.4 ) |
Gene: BLi01881: endoglucanase A (Endo-1,4-beta-glucanase A)(Cellulase A)( EC 3.2.1.4 ) |
|
|
|
|
|
|
|
endoglucanase A (Endo-1,4-beta-glucanase A)(Cellulase A)( EC 3.2.1.4 ) |
| CRON 5. | ||||||||||||
| BLi03540 |
|
|
|
*
Bacillus licheniformis DSM 13 Site: position = -52 score = 5.95088 sequence = ACTTAGTTTAGCTATTAAACTAACA Gene: BLi03540: Possible alpha-xyloside ABC transporter, substrate-binding component |
|
|
|
|
|
|
|
Possible alpha-xyloside ABC transporter, substrate-binding component |
| yurN |
|
|
|
Gene: BLi03541: Possible alpha-xyloside ABC transporter, permease component |
|
|
|
|
|
|
|
Possible alpha-xyloside ABC transporter, permease component |
| yurM |
|
|
|
Gene: BLi03542: Possible alpha-xyloside ABC transporter, permease component |
|
|
|
|
|
|
|
Possible alpha-xyloside ABC transporter, permease component |
| xylS |
|
|
|
Gene: BLi03543: Alpha-glucosidase |
|
|
|
Gene: BH1905: Alpha-glucosidase |
Gene: ABC1132: Alpha-glucosidase |
|
Gene: Pjdr2_1930: Alpha-glucosidase |
Alpha-glucosidase |
| bglS |
|
|
|
Gene: BLi03544: Beta-glucosidase (EC 3.2.1.21) |
|
|
|
Gene: BH1908: Beta-glucosidase (EC 3.2.1.21) |
|
|
Gene: Pjdr2_1931: Beta-glucosidase (EC 3.2.1.21) |
Beta-glucosidase (EC 3.2.1.21) |
| CRON 6. | ||||||||||||
| xylR |
*
Bacillus subtilis subsp. subtilis str. 168 Site: position = -268 score = 6.59666 sequence = AGTTTGTTGTTTAAACAAACTAACT Gene: BSU17590: Transcriptional repressor of the xylose metabolism, ROK family |
*
Bacillus amyloliquefaciens FZB42 Site: position = -187 score = 6.13996 sequence = AGTTTGTTGCCCAAACAAACTAACT Gene: RBAM_017340: Transcriptional repressor of the xylose metabolism, ROK family |
*
Bacillus pumilus SAFR-032 Site: position = -191 score = 5.90071 sequence = ACTTTGTAAGTTGATTCAACAAACT Gene: BPUM_1830: Transcriptional repressor of the xylose metabolism, ROK family |
*
Bacillus licheniformis DSM 13 Site: position = -147 score = 6.41828 sequence = TGTTTGTTTAACCATTAAACTAACT Gene: BLi04049: Transcriptional repressor of the xylose metabolism, ROK family |
|
*
Geobacillus kaustophilus HTA426 Site: position = -230 score = 6.00208 sequence = AATTAGTTTATTATATAAACTAAGA Gene: GK2422: Transcriptional repressor of the xylose metabolism, ROK family |
|
*
Bacillus halodurans C-125 Site: position = -151 score = 6.67694 sequence = ACTTAGTTTATTCAATAGACAAACT Gene: BH2758: Transcriptional repressor of the xylose metabolism, ROK family |
Gene: ABC0575: Transcriptional repressor of the xylose metabolism, ROK family |
*
Oceanobacillus iheyensis HTE831 Site: position = -87 score = 5.81055 sequence = TGTTTGTCTACCGGTTAAACAAAGT Gene: OB3124: Transcriptional repressor of the xylose metabolism, ROK family |
*
Paenibacillus sp. JDR-2 Site: position = -113 score = 6.65714 sequence = AGTTTGTCTATTAAACAAACTAAGT Gene: Pjdr2_5182: Transcriptional repressor of the xylose metabolism, ROK family |
Transcriptional repressor of the xylose metabolism, ROK family |
| xynB |
Gene: BSU17580: Beta-xylosidase (EC 3.2.1.37) |
Gene: RBAM_017330: Beta-xylosidase (EC 3.2.1.37) |
Gene: BPUM_1831: Beta-xylosidase (EC 3.2.1.37) |
|
|
|
|
|
Gene: ABC0554: Beta-xylosidase (EC 3.2.1.37) |
Gene: OB3125: Beta-xylosidase (EC 3.2.1.37) |
Gene: Pjdr2_0750: Beta-xylosidase (EC 3.2.1.37) |
Beta-xylosidase (EC 3.2.1.37) |
| xynP |
*
Bacillus subtilis subsp. subtilis str. 168 Site: position = -320 score = 6.79519 sequence = AGTTAGTTTGTTTGATCAACAAACT Gene: BSU17570: Putative H+-xyloside symporter |
*
Bacillus amyloliquefaciens FZB42 Site: position = -304 score = 6.35828 sequence = AGTTAGTTTGTTCGGTCAACAAACT Gene: RBAM_017320: Putative H+-xyloside symporter |
*
Bacillus pumilus SAFR-032 Site: position = -231 score = 6.13086 sequence = AGTTTGTTTGGTCAATAAACTAAGA Gene: BPUM_1832: Putative H+-xyloside symporter |
|
|
|
|
|
|
|
|
Putative H+-xyloside symporter |
| CRON 7. | ||||||||||||
| xylG |
|
|
|
|
|
*
Geobacillus kaustophilus HTA426 Site: position = -44 score = 5.78392 sequence = ACTTAGTTTATTAATCTAACTATCT Gene: GK1880: D-xylose ABC transporter (ATP binding protein) |
|
|
|
|
|
D-xylose ABC transporter (ATP binding protein) |
| xylH |
|
|
|
|
|
Gene: GK1879: D-xylose ABC transporter (permease) |
|
|
|
|
|
D-xylose ABC transporter (permease) |
| GK1878 |
|
|
|
|
|
Gene: GK1878: Oxidoreductase |
|
|
|
|
|
Oxidoreductase |
| galM |
|
|
|
|
Gene: Aflv_0538: Aldose 1-epimerase (EC 5.1.3.3) |
Gene: GK1877: Aldose 1-epimerase (EC 5.1.3.3) |
|
Gene: BH2755: Aldose 1-epimerase (EC 5.1.3.3) |
Gene: ABC0574: Aldose 1-epimerase (EC 5.1.3.3) |
Gene: OB2208: Aldose 1-epimerase (EC 5.1.3.3) |
|
Aldose 1-epimerase (EC 5.1.3.3) |
| xylA |
*
Bacillus subtilis subsp. subtilis str. 168 Site: position = -100 score = 6.59666 sequence = AGTTAGTTTGTTTAAACAACAAACT Gene: BSU17600: Xylose isomerase (EC 5.3.1.5) |
*
Bacillus amyloliquefaciens FZB42 Site: position = -101 score = 6.13996 sequence = AGTTAGTTTGTTTGGGCAACAAACT Gene: RBAM_017350: Xylose isomerase (EC 5.3.1.5) |
*
Bacillus pumilus SAFR-032 Site: position = -47 score = 5.90071 sequence = AGTTTGTTGAATCAACTTACAAAGT Gene: BPUM_1829: Xylose isomerase (EC 5.3.1.5) |
*
Bacillus licheniformis DSM 13 Site: position = -69 score = 6.41828 sequence = AGTTAGTTTAATGGTTAAACAAACA Gene: BLi04048: Xylose isomerase (EC 5.3.1.5) |
|
*
Geobacillus kaustophilus HTA426 Site: position = -87 score = 6.29866 sequence = ACTTTGTTTATATGATAGACAAACA Gene: GK1875: Xylose isomerase (EC 5.3.1.5) |
|
*
Bacillus halodurans C-125 Site: position = -102 score = 6.67694 sequence = AGTTTGTCTATTGAATAAACTAAGT Gene: BH2757: Xylose isomerase (EC 5.3.1.5) |
*
Bacillus clausii KSM-K16 Site: position = -45 score = 6.29605 sequence = ACTTAGTTTAAATAATAAACAAACC Gene: ABC0572: Xylose isomerase (EC 5.3.1.5) |
*
Oceanobacillus iheyensis HTE831 Site: position = -44 score = 6.70639 sequence = ACTTTGTTTGTTAGATAAACAAACA Gene: OB3119: Xylose isomerase (EC 5.3.1.5) |
*
Paenibacillus sp. JDR-2 Site: position = -123 score = 6.65337 sequence = AGTTTGTTTAATAGACAAACTAAGT Gene: Pjdr2_5159: Xylose isomerase (EC 5.3.1.5) |
Xylose isomerase (EC 5.3.1.5) |
| xylB |
Gene: BSU17610: Xylulose kinase (EC 2.7.1.17) |
Gene: RBAM_017360: Xylulose kinase (EC 2.7.1.17) |
Gene: BPUM_1828: Xylulose kinase (EC 2.7.1.17) |
Gene: BLi04047: Xylulose kinase (EC 2.7.1.17) |
|
Gene: GK1874: Xylulose kinase (EC 2.7.1.17) |
|
Gene: BH2756: Xylulose kinase (EC 2.7.1.17) |
Gene: ABC0573: Xylulose kinase (EC 2.7.1.17) |
Gene: OB3118: Xylulose kinase (EC 2.7.1.17) |
Gene: Pjdr2_5158: Xylulose kinase (EC 2.7.1.17) |
Xylulose kinase (EC 2.7.1.17) |
| CRON 8. | ||||||||||||
| ABC3215 |
|
|
|
|
|
|
|
|
*
Bacillus clausii KSM-K16 Site: position = -56 score = 6.36924 sequence = ACTTAGTTTATTTCATAAACAAACA Gene: ABC3215: Possible alpha-xyloside ABC transporter, substrate-binding component |
|
Gene: Pjdr2_5598: Possible alpha-xyloside ABC transporter, substrate-binding component |
Possible alpha-xyloside ABC transporter, substrate-binding component |
| ABC3214 |
|
|
|
|
|
|
|
|
Gene: ABC3214: Possible alpha-xyloside ABC transporter, permease component |
|
Gene: Pjdr2_5597: Possible alpha-xyloside ABC transporter, permease component |
Possible alpha-xyloside ABC transporter, permease component |
| ABC3213 |
|
|
|
|
|
|
|
|
Gene: ABC3213: Possible alpha-xyloside ABC transporter, permease component |
|
Gene: Pjdr2_5596: Possible alpha-xyloside ABC transporter, permease component |
Possible alpha-xyloside ABC transporter, permease component |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |