Regulon of XylR in Oceanobacillus iheyensis HTE831

Properties
Regulator type:	Transcription factor
TF locus tag:	OB3124
Regulator family:	ROK
Regulation mode:	repressor
Biological process:	Xylose utilization
Effector:	Xylose
Regulog:	XylR - Bacillales
Statistics of regulated genes:
- Genes	7
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 28 sites [see more]

Member of regulog collections

By trascription factor - XylR
By taxonomy - Bacillales
By TF family - ROK
By effector - Xylose
By pathway - Xylose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -87 Score: 5.8 Sequence: TGTTTGTCTACCGGTTAAACAAAGT Locus tag: OB3124 Name: xylR Funciton: Transcriptional repressor of the xylose metabolism, ROK family Locus tag: OB3125 Name: xynB Funciton: Beta-xylosidase (EC 3.2.1.37)
	OB3124	xylR	Transcriptional repressor of the xylose metabolism, ROK family
	OB3125	xynB	Beta-xylosidase (EC 3.2.1.37)
Position: -44 Score: 6.7 Sequence: ACTTTGTTTGTTAGATAAACAAACA Locus tag: OB3119 Name: xylA Funciton: Xylose isomerase (EC 5.3.1.5) Locus tag: OB3118 Name: xylB Funciton: Xylulose kinase (EC 2.7.1.17)
	OB3119	xylA	Xylose isomerase (EC 5.3.1.5)
	OB3118	xylB	Xylulose kinase (EC 2.7.1.17)
Position: -90 Score: 5.8 Sequence: ACTTTGTTTAACCGGTAGACAAACA Locus tag: OB3123 Name: null Funciton: Predicted beta-xyloside ABC transporter, substrate-binding component Locus tag: OB3122 Name: null Funciton: Predicted beta-xyloside ABC transporter, permease component Locus tag: OB3121 Name: null Funciton: Predicted beta-xyloside ABC transporter, ATP-binding component
	OB3123		Predicted beta-xyloside ABC transporter, substrate-binding component
	OB3122		Predicted beta-xyloside ABC transporter, permease component
	OB3121		Predicted beta-xyloside ABC transporter, ATP-binding component

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD