Regulon of XylR in Paenibacillus sp. JDR-2

Properties
Regulator type:	Transcription factor
TF locus tag:	Pjdr2_5182
Regulator family:	ROK
Regulation mode:	repressor
Biological process:	Xylose utilization
Effector:	Xylose
Regulog:	XylR - Bacillales
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 28 sites [see more]

Member of regulog collections

By trascription factor - XylR
By taxonomy - Bacillales
By TF family - ROK
By effector - Xylose
By pathway - Xylose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -113 Score: 6.7 Sequence: AGTTTGTCTATTAAACAAACTAAGT Locus tag: Pjdr2_5182 Name: xylR Funciton: Transcriptional repressor of the xylose metabolism, ROK family
	Pjdr2_5182	xylR	Transcriptional repressor of the xylose metabolism, ROK family
Position: -123 Score: 6.7 Sequence: AGTTTGTTTAATAGACAAACTAAGT Locus tag: Pjdr2_5159 Name: xylA Funciton: Xylose isomerase (EC 5.3.1.5) Locus tag: Pjdr2_5158 Name: xylB Funciton: Xylulose kinase (EC 2.7.1.17)
	Pjdr2_5159	xylA	Xylose isomerase (EC 5.3.1.5)
	Pjdr2_5158	xylB	Xylulose kinase (EC 2.7.1.17)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD