Regulon of XylR in Bacillus clausii KSM-K16

Properties
Regulator type:	Transcription factor
TF locus tag:	ABC0575
Regulator family:	ROK
Regulation mode:	repressor
Biological process:	Xylose utilization
Effector:	Xylose
Regulog:	XylR - Bacillales
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 28 sites [see more]

Member of regulog collections

By trascription factor - XylR
By taxonomy - Bacillales
By TF family - ROK
By effector - Xylose
By pathway - Xylose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -45 Score: 6.3 Sequence: ACTTAGTTTAAATAATAAACAAACC Locus tag: ABC0572 Name: xylA Funciton: Xylose isomerase (EC 5.3.1.5) Locus tag: ABC0573 Name: xylB Funciton: Xylulose kinase (EC 2.7.1.17) Locus tag: ABC0574 Name: galM Funciton: Aldose 1-epimerase (EC 5.1.3.3)
	ABC0572	xylA	Xylose isomerase (EC 5.3.1.5)
	ABC0573	xylB	Xylulose kinase (EC 2.7.1.17)
	ABC0574	galM	Aldose 1-epimerase (EC 5.1.3.3)
Position: -56 Score: 6.4 Sequence: ACTTAGTTTATTTCATAAACAAACA Locus tag: ABC3215 Name: null Funciton: Possible alpha-xyloside ABC transporter, substrate-binding component Locus tag: ABC3214 Name: null Funciton: Possible alpha-xyloside ABC transporter, permease component Locus tag: ABC3213 Name: null Funciton: Possible alpha-xyloside ABC transporter, permease component
	ABC3215		Possible alpha-xyloside ABC transporter, substrate-binding component
	ABC3214		Possible alpha-xyloside ABC transporter, permease component
	ABC3213		Possible alpha-xyloside ABC transporter, permease component

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD