Regulon of XylR in Bacillus licheniformis DSM 13

Properties
Regulator type:	Transcription factor
TF locus tag:	BLi04049
Regulator family:	ROK
Regulation mode:	repressor
Biological process:	Xylose utilization
Effector:	Xylose
Regulog:	XylR - Bacillales
Statistics of regulated genes:
- Genes	10
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 28 sites [see more]

Member of regulog collections

By trascription factor - XylR
By taxonomy - Bacillales
By TF family - ROK
By effector - Xylose
By pathway - Xylose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -147 Score: 6.4 Sequence: TGTTTGTTTAACCATTAAACTAACT Locus tag: BLi04049 Name: xylR Funciton: Transcriptional repressor of the xylose metabolism, ROK family
	BLi04049	xylR	Transcriptional repressor of the xylose metabolism, ROK family
Position: -69 Score: 6.4 Sequence: AGTTAGTTTAATGGTTAAACAAACA Locus tag: BLi04048 Name: xylA Funciton: Xylose isomerase (EC 5.3.1.5) Locus tag: BLi04047 Name: xylB Funciton: Xylulose kinase (EC 2.7.1.17)
	BLi04048	xylA	Xylose isomerase (EC 5.3.1.5)
	BLi04047	xylB	Xylulose kinase (EC 2.7.1.17)
Position: -202 Score: 6.3 Sequence: ACTTAGTTTATTGAACAAATAAACT Locus tag: BLi01880 Name: gunA Funciton: Endoglucanase 4 precursor (EC 3.2.1.4) Locus tag: BLi01881 Name: gunB Funciton: endoglucanase A (Endo-1,4-beta-glucanase A)(Cellulase A)( EC 3.2.1.4 )
	BLi01880	gunA	Endoglucanase 4 precursor (EC 3.2.1.4)
	BLi01881	gunB	endoglucanase A (Endo-1,4-beta-glucanase A)(Cellulase A)( EC 3.2.1.4 )
Position: -52 Score: 6 Sequence: ACTTAGTTTAGCTATTAAACTAACA Locus tag: BLi03540 Name: null Funciton: Possible alpha-xyloside ABC transporter, substrate-binding component Locus tag: BLi03541 Name: yurN Funciton: Possible alpha-xyloside ABC transporter, permease component Locus tag: BLi03542 Name: yurM Funciton: Possible alpha-xyloside ABC transporter, permease component Locus tag: BLi03543 Name: xylS Funciton: Alpha-glucosidase Locus tag: BLi03544 Name: bglS Funciton: Beta-glucosidase (EC 3.2.1.21)
	BLi03540		Possible alpha-xyloside ABC transporter, substrate-binding component
	BLi03541	yurN	Possible alpha-xyloside ABC transporter, permease component
	BLi03542	yurM	Possible alpha-xyloside ABC transporter, permease component
	BLi03543	xylS	Alpha-glucosidase
	BLi03544	bglS	Beta-glucosidase (EC 3.2.1.21)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD