Regulon of XylR in Bacillus halodurans C-125

Properties
Regulator type:	Transcription factor
TF locus tag:	BH2758
Regulator family:	ROK
Regulation mode:	repressor
Biological process:	Xylose utilization
Effector:	Xylose
Regulog:	XylR - Bacillales
Statistics of regulated genes:
- Genes	12
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 28 sites [see more]

Member of regulog collections

By trascription factor - XylR
By taxonomy - Bacillales
By TF family - ROK
By effector - Xylose
By pathway - Xylose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -192 Score: 5.8 Sequence: AGTTTGTTCACTGGATCAACTAAGT Locus tag: BH2120 Name: xynA Funciton: Endo-1,4-beta-xylanase A precursor (EC 3.2.1.8)
	BH2120	xynA	Endo-1,4-beta-xylanase A precursor (EC 3.2.1.8)
Position: -151 Score: 6.7 Sequence: ACTTAGTTTATTCAATAGACAAACT Locus tag: BH2758 Name: xylR Funciton: Transcriptional repressor of the xylose metabolism, ROK family
	BH2758	xylR	Transcriptional repressor of the xylose metabolism, ROK family
Position: -165 Score: 6.1 Sequence: ACTTTGTTTAATGGTAAAACAAAGT Locus tag: BH3678 Name: BH3678 Funciton: Two-component sensor histidine kinase Locus tag: BH3679 Name: BH3679 Funciton: Two component transcriptional regulator, AraC family Locus tag: BH3680 Name: BH3680 Funciton: Predicted beta-xyloside ABC transporter, substrate-binding component Locus tag: BH3681 Name: BH3681 Funciton: Predicted beta-xyloside ABC transporter, permease component Locus tag: BH3682 Name: BH3682 Funciton: Predicted beta-xyloside ABC transporter, ATP-binding component Locus tag: BH3683 Name: xynB Funciton: Beta-xylosidase (EC 3.2.1.37) Locus tag: BH3684 Name: BH3684 Funciton: Putative permease
	BH3678	BH3678	Two-component sensor histidine kinase
	BH3679	BH3679	Two component transcriptional regulator, AraC family
	BH3680	BH3680	Predicted beta-xyloside ABC transporter, substrate-binding component
	BH3681	BH3681	Predicted beta-xyloside ABC transporter, permease component
	BH3682	BH3682	Predicted beta-xyloside ABC transporter, ATP-binding component
	BH3683	xynB	Beta-xylosidase (EC 3.2.1.37)
	BH3684	BH3684	Putative permease
Position: -102 Score: 6.7 Sequence: AGTTTGTCTATTGAATAAACTAAGT Locus tag: BH2757 Name: xylA Funciton: Xylose isomerase (EC 5.3.1.5) Locus tag: BH2756 Name: xylB Funciton: Xylulose kinase (EC 2.7.1.17) Locus tag: BH2755 Name: galM Funciton: Aldose 1-epimerase (EC 5.1.3.3)
	BH2757	xylA	Xylose isomerase (EC 5.3.1.5)
	BH2756	xylB	Xylulose kinase (EC 2.7.1.17)
	BH2755	galM	Aldose 1-epimerase (EC 5.1.3.3)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD