Regulon of XylR in Geobacillus kaustophilus HTA426

Properties
Regulator type:	Transcription factor
TF locus tag:	GK2422
Regulator family:	ROK
Regulation mode:	repressor
Biological process:	Xylose utilization
Effector:	Xylose
Regulog:	XylR - Bacillales
Statistics of regulated genes:
- Genes	8
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 28 sites [see more]

Member of regulog collections

By trascription factor - XylR
By taxonomy - Bacillales
By TF family - ROK
By effector - Xylose
By pathway - Xylose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -230 Score: 6 Sequence: AATTAGTTTATTATATAAACTAAGA Locus tag: GK2422 Name: xylR Funciton: Transcriptional repressor of the xylose metabolism, ROK family
	GK2422	xylR	Transcriptional repressor of the xylose metabolism, ROK family
Position: -89 Score: 5.6 Sequence: ACTTTGTTTGTATTATGGACAAACA Locus tag: GK1881 Name: xylF Funciton: D-xylose ABC transporter (substrate-binding protein)
	GK1881	xylF	D-xylose ABC transporter (substrate-binding protein)
Position: -87 Score: 6.3 Sequence: ACTTTGTTTATATGATAGACAAACA Locus tag: GK1875 Name: xylA Funciton: Xylose isomerase (EC 5.3.1.5) Locus tag: GK1874 Name: xylB Funciton: Xylulose kinase (EC 2.7.1.17)
	GK1875	xylA	Xylose isomerase (EC 5.3.1.5)
	GK1874	xylB	Xylulose kinase (EC 2.7.1.17)
Position: -44 Score: 5.8 Sequence: ACTTAGTTTATTAATCTAACTATCT Locus tag: GK1880 Name: xylG Funciton: D-xylose ABC transporter (ATP binding protein) Locus tag: GK1879 Name: xylH Funciton: D-xylose ABC transporter (permease) Locus tag: GK1878 Name: GK1878 Funciton: Oxidoreductase Locus tag: GK1877 Name: galM Funciton: Aldose 1-epimerase (EC 5.1.3.3)
	GK1880	xylG	D-xylose ABC transporter (ATP binding protein)
	GK1879	xylH	D-xylose ABC transporter (permease)
	GK1878	GK1878	Oxidoreductase
	GK1877	galM	Aldose 1-epimerase (EC 5.1.3.3)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD