Regulog AraR - Thermotogales

Properties
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Arabinose utilization
Effector:	Arabinose
Phylum:	Thermotogae
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 35 sites [see more]

Member of regulog collections

By taxonomy - Thermotogales
By trascription factor - AraR
By TF family - GntR/Others
By effector - Arabinose
By pathway - Arabinose utilization

Statistics of regulated genes
Genome	Genes	Operons
Thermotoga maritima MSB8	9	3
Thermotoga sp. RQ2	21	5
Thermotoga neapolitana DSM 4359	3	2
Thermotoga petrophila RKU-1	22	5
Thermotoga naphthophila RKU-10	10	3
Thermotoga lettingae TMO	10	2
Thermosipho africanus TCF52B
Thermosipho melanesiensis BI429
Fervidobacterium nodosum Rt17-B1
Petrotoga mobilis SJ95
Thermotogales bacterium TBF 19.5.1

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes												Function

CRON 1.
araN-II	Thermotoga maritima MSB8	* Thermotoga sp. RQ2 Site: position = -50 score = 5.74643 sequence = AAATTGGTACGTACCTATCT Site: position = -233 score = 5.35162 sequence = CATTTTGTACGTACATATAT Gene: TRQ2_0661: Predicted arabinose ABC transporter, substrate binding protein	Thermotoga neapolitana DSM 4359	* Thermotoga petrophila RKU-1 Site: position = -233 score = 5.35162 sequence = CATTTTGTACGTACATATAT Site: position = -50 score = 5.74643 sequence = AAATTGGTACGTACCTATCT Gene: Tpet_0636: Predicted arabinose ABC transporter, substrate binding protein	Thermotoga naphthophila RKU-10	* Thermotoga lettingae TMO Site: position = -169 score = 4.99913 sequence = TAATTTGTATGTACATATAT Gene: Tlet_1143: Predicted arabinose ABC transporter, substrate binding protein	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	Predicted arabinose ABC transporter, substrate binding protein
araP-II	Thermotoga maritima MSB8	Thermotoga sp. RQ2 Gene: TRQ2_0660: Alpha-arabinosides ABC transport system, permease protein 1	Thermotoga neapolitana DSM 4359	Thermotoga petrophila RKU-1 Gene: Tpet_0635: Alpha-arabinosides ABC transport system, permease protein 1	Thermotoga naphthophila RKU-10	Thermotoga lettingae TMO Gene: Tlet_1144: Alpha-arabinosides ABC transport system, permease protein 1	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	Alpha-arabinosides ABC transport system, permease protein 1
araQ-II	Thermotoga maritima MSB8	Thermotoga sp. RQ2 Gene: TRQ2_0659: Alpha-arabinosides ABC transport system, permease protein 2	Thermotoga neapolitana DSM 4359	Thermotoga petrophila RKU-1 Gene: Tpet_0634: Alpha-arabinosides ABC transport system, permease protein 2	Thermotoga naphthophila RKU-10	Thermotoga lettingae TMO Gene: Tlet_1145: Alpha-arabinosides ABC transport system, permease protein 2	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	Alpha-arabinosides ABC transport system, permease protein 2
abf3	Thermotoga maritima MSB8	Thermotoga sp. RQ2 Gene: TRQ2_0658: Alpha-N-arabinofuranosidase II (EC 3.2.1.55)	Thermotoga neapolitana DSM 4359	Thermotoga petrophila RKU-1 Gene: Tpet_0633: Alpha-N-arabinofuranosidase II (EC 3.2.1.55)	Thermotoga naphthophila RKU-10	Thermotoga lettingae TMO Gene: Tlet_1147: Alpha-N-arabinofuranosidase II (EC 3.2.1.55)	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	Alpha-N-arabinofuranosidase II (EC 3.2.1.55)
xylX	Thermotoga maritima MSB8	Thermotoga sp. RQ2 Gene: TRQ2_0657: Secreted glycosyl hydrolase, similar to xylosidase	Thermotoga neapolitana DSM 4359	Thermotoga petrophila RKU-1 Gene: Tpet_0632: Secreted glycosyl hydrolase, similar to xylosidase	Thermotoga naphthophila RKU-10	Thermotoga lettingae TMO	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	Secreted glycosyl hydrolase, similar to xylosidase
abfA	Thermotoga maritima MSB8 Gene: TM0281: Alpha-N-arabinofuranosidase (EC 3.2.1.55)	Thermotoga sp. RQ2 Gene: TRQ2_0656: Alpha-N-arabinofuranosidase (EC 3.2.1.55)	Thermotoga neapolitana DSM 4359 Gene: CTN_0403: Alpha-N-arabinofuranosidase (EC 3.2.1.55)	Thermotoga petrophila RKU-1 Gene: Tpet_0631: Alpha-N-arabinofuranosidase (EC 3.2.1.55)	Thermotoga naphthophila RKU-10 Gene: Tnap_0911: Alpha-N-arabinofuranosidase (EC 3.2.1.55)	Thermotoga lettingae TMO Gene: Tlet_1148: Alpha-N-arabinofuranosidase (EC 3.2.1.55)	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	Alpha-N-arabinofuranosidase (EC 3.2.1.55)
araM	Thermotoga maritima MSB8 Gene: TM0282: L-arabinose-specific 1-epimerase (mutarotase)	Thermotoga sp. RQ2 Gene: TRQ2_0655: L-arabinose-specific 1-epimerase (mutarotase)	Thermotoga neapolitana DSM 4359 Gene: CTN_0402: L-arabinose-specific 1-epimerase (mutarotase)	Thermotoga petrophila RKU-1 Gene: Tpet_0630: L-arabinose-specific 1-epimerase (mutarotase)	Thermotoga naphthophila RKU-10 Gene: Tnap_0912: L-arabinose-specific 1-epimerase (mutarotase)	Thermotoga lettingae TMO	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	L-arabinose-specific 1-epimerase (mutarotase)
araD	Thermotoga maritima MSB8 Gene: TM0283: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)	Thermotoga sp. RQ2 Gene: TRQ2_0654: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)	Thermotoga neapolitana DSM 4359 Gene: CTN_0401: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)	Thermotoga petrophila RKU-1 Gene: Tpet_0629: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)	Thermotoga naphthophila RKU-10 Gene: Tnap_0915: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)	Thermotoga lettingae TMO Gene: Tlet_1139: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
araB	Thermotoga maritima MSB8 Gene: TM0284: Ribulokinase (EC 2.7.1.16)	Thermotoga sp. RQ2 Gene: TRQ2_0653: Ribulokinase (EC 2.7.1.16)	Thermotoga neapolitana DSM 4359 Gene: CTN_0400: Ribulokinase (EC 2.7.1.16)	Thermotoga petrophila RKU-1 Gene: Tpet_0628: Ribulokinase (EC 2.7.1.16)	Thermotoga naphthophila RKU-10 Gene: Tnap_0916: Ribulokinase (EC 2.7.1.16)	Thermotoga lettingae TMO Gene: Tlet_1150: Ribulokinase (EC 2.7.1.16)	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	Ribulokinase (EC 2.7.1.16)
araW	Thermotoga maritima MSB8 Gene: TM0285: Predicted glycerol-1-phosphate dehydrogenase, arabinose operon	Thermotoga sp. RQ2 Gene: TRQ2_0652: Predicted glycerol-1-phosphate dehydrogenase, arabinose operon	Thermotoga neapolitana DSM 4359 Gene: CTN_0399: Predicted glycerol-1-phosphate dehydrogenase, arabinose operon	Thermotoga petrophila RKU-1 Gene: Tpet_0627: Predicted glycerol-1-phosphate dehydrogenase, arabinose operon	Thermotoga naphthophila RKU-10 Gene: Tnap_0917: Predicted glycerol-1-phosphate dehydrogenase, arabinose operon	Thermotoga lettingae TMO	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	Predicted glycerol-1-phosphate dehydrogenase, arabinose operon
xynB	Thermotoga maritima MSB8	Thermotoga sp. RQ2	Thermotoga neapolitana DSM 4359	Thermotoga petrophila RKU-1	Thermotoga naphthophila RKU-10	Thermotoga lettingae TMO Gene: Tlet_1146: Endo-1,4-beta-xylanase	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	Endo-1,4-beta-xylanase
araA-II	Thermotoga maritima MSB8	Thermotoga sp. RQ2	Thermotoga neapolitana DSM 4359	Thermotoga petrophila RKU-1	Thermotoga naphthophila RKU-10	Thermotoga lettingae TMO Gene: Tlet_1149: Predicted L-arabinose isomerase (EC 5.3.1.4)	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	Predicted L-arabinose isomerase (EC 5.3.1.4)
glsA	* Thermotoga maritima MSB8 Site: position = -44 score = 5.93951 sequence = AATAATGTACGTACCTAAAT Gene: TM0280: Putative glycosyl hydrolase of unknown function (DUF1680)	* Thermotoga sp. RQ2 Site: position = -58 score = 5.93951 sequence = AATAATGTACGTACCTAAAT Gene: TRQ2_0668: Putative glycosyl hydrolase of unknown function (DUF1680)	Thermotoga neapolitana DSM 4359 Gene: CTN_0404: Putative glycosyl hydrolase of unknown function (DUF1680)	* Thermotoga petrophila RKU-1 Site: position = -55 score = 5.03261 sequence = GATAATATACGTACCTAAAT Gene: Tpet_0643: Putative glycosyl hydrolase of unknown function (DUF1680)	* Thermotoga naphthophila RKU-10 Site: position = -55 score = 5.03261 sequence = GATAATATACGTACCTAAAT Gene: Tnap_0910: Putative glycosyl hydrolase of unknown function (DUF1680)	Thermotoga lettingae TMO	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	Putative glycosyl hydrolase of unknown function (DUF1680)
Tnap_0913	Thermotoga maritima MSB8	Thermotoga sp. RQ2	Thermotoga neapolitana DSM 4359	Thermotoga petrophila RKU-1	* Thermotoga naphthophila RKU-10 Site: position = -56 score = 4.89355 sequence = TATAATGTACGTACCTATCA Gene: Tnap_0913: predicted arabinose ABC transporter, sugar-binding protein	Thermotoga lettingae TMO	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	predicted arabinose ABC transporter, sugar-binding protein
Tnap_0914	Thermotoga maritima MSB8	Thermotoga sp. RQ2	Thermotoga neapolitana DSM 4359	Thermotoga petrophila RKU-1	Thermotoga naphthophila RKU-10 Gene: Tnap_0914: predicted arabinose ABC transporter, permease component	Thermotoga lettingae TMO	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	predicted arabinose ABC transporter, permease component
araR	Thermotoga maritima MSB8 Gene: TM0275: Transcriptional repressor of arabinoside utilization operon, GntR family	Thermotoga sp. RQ2 Gene: TRQ2_0673: Transcriptional repressor of arabinoside utilization operon, GntR family	Thermotoga neapolitana DSM 4359 Gene: CTN_0410: Transcriptional repressor of arabinoside utilization operon, GntR family	Thermotoga petrophila RKU-1 Gene: Tpet_0649: Transcriptional repressor of arabinoside utilization operon, GntR family	Thermotoga naphthophila RKU-10 Gene: Tnap_0905: Transcriptional repressor of arabinoside utilization operon, GntR family	* Thermotoga lettingae TMO Site: position = 27 score = 5.34936 sequence = ATTTATGTACGTACGTTTAC Gene: Tlet_1138: Transcriptional repressor of arabinoside utilization operon, GntR family	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	Transcriptional repressor of arabinoside utilization operon, GntR family

CRON 2.
araA	* Thermotoga maritima MSB8 Site: position = -164 score = 4.7066 sequence = ATAACGGTACGTACCGATGG Site: position = -62 score = 6.28709 sequence = ATAATGGTACGTACTTTTAT Gene: TM0276: L-arabinose isomerase (EC 5.3.1.4)	* Thermotoga sp. RQ2 Site: position = -62 score = 6.51559 sequence = ATAAAGGTACGTACTTTTAT Site: position = -164 score = 4.7066 sequence = ATAACGGTACGTACCGATGG Gene: TRQ2_0672: L-arabinose isomerase (EC 5.3.1.4)	* Thermotoga neapolitana DSM 4359 Site: position = -62 score = 6.18535 sequence = ATAAAGGTACGTACTTTTGT Site: position = -165 score = 4.70179 sequence = ATATCGGTACGTACCAGTTG Gene: CTN_0409: L-arabinose isomerase (EC 5.3.1.4)	* Thermotoga petrophila RKU-1 Site: position = -62 score = 6.51559 sequence = ATAAAGGTACGTACTTTTAT Site: position = -164 score = 4.7066 sequence = ATAACGGTACGTACCGATGG Gene: Tpet_0648: L-arabinose isomerase (EC 5.3.1.4)	* Thermotoga naphthophila RKU-10 Site: position = -62 score = 6.51559 sequence = ATAAAGGTACGTACTTTTAT Site: position = -164 score = 4.7066 sequence = ATAACGGTACGTACCGATGG Gene: Tnap_0906: L-arabinose isomerase (EC 5.3.1.4)	Thermotoga lettingae TMO	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	L-arabinose isomerase (EC 5.3.1.4)

CRON 3.
abf6	Thermotoga maritima MSB8	2 Thermotoga sp. RQ2* Site: position = -221 score = 5.74643 sequence = AGATAGGTACGTACCAATTT Site: position = -38 score = 5.35162 sequence = ATATATGTACGTACAAAATG Gene: TRQ2_0662: Predicted Aapha-N-arabinofuranosidase (EC 3.2.1.55) Gene: TRQ2_0664: Predicted Aapha-N-arabinofuranosidase (EC 3.2.1.55)	Thermotoga neapolitana DSM 4359	2 Thermotoga petrophila RKU-1* Site: position = -221 score = 5.74643 sequence = AGATAGGTACGTACCAATTT Site: position = -38 score = 5.35162 sequence = ATATATGTACGTACAAAATG Gene: Tpet_0637: Predicted Aapha-N-arabinofuranosidase (EC 3.2.1.55) Gene: Tpet_0639: Predicted Aapha-N-arabinofuranosidase (EC 3.2.1.55)	Thermotoga naphthophila RKU-10	Thermotoga lettingae TMO	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	Predicted Aapha-N-arabinofuranosidase (EC 3.2.1.55)
lamG1	Thermotoga maritima MSB8	Thermotoga sp. RQ2 Gene: TRQ2_0663: Laminin G domain-containing protein	Thermotoga neapolitana DSM 4359	Thermotoga petrophila RKU-1 Gene: Tpet_0638: Laminin G domain-containing protein	Thermotoga naphthophila RKU-10	Thermotoga lettingae TMO	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	Laminin G domain-containing protein
conA1	Thermotoga maritima MSB8	Thermotoga sp. RQ2 Gene: TRQ2_0665: Con A-like domain-containing protein	Thermotoga neapolitana DSM 4359	Thermotoga petrophila RKU-1 Gene: Tpet_0640: Con A-like domain-containing protein	Thermotoga naphthophila RKU-10	Thermotoga lettingae TMO	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	Con A-like domain-containing protein
conA2	Thermotoga maritima MSB8	Thermotoga sp. RQ2 Gene: TRQ2_0666: Con A-like domain-containing protein	Thermotoga neapolitana DSM 4359	Thermotoga petrophila RKU-1 Gene: Tpet_0641: Con A-like domain-containing protein	Thermotoga naphthophila RKU-10	Thermotoga lettingae TMO	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	Con A-like domain-containing protein
lamG2	Thermotoga maritima MSB8	Thermotoga sp. RQ2 Gene: TRQ2_0667: Laminin G domain-containing protein	Thermotoga neapolitana DSM 4359	Thermotoga petrophila RKU-1 Gene: Tpet_0642: Laminin G domain-containing protein	Thermotoga naphthophila RKU-10	Thermotoga lettingae TMO	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	Laminin G domain-containing protein

CRON 4.
araE	Thermotoga maritima MSB8	* Thermotoga sp. RQ2 Site: position = -150 score = 6.51559 sequence = ATAAAAGTACGTACCTTTAT Site: position = -48 score = 4.7066 sequence = CCATCGGTACGTACCGTTAT Gene: TRQ2_0671: Predicted arabinosides or arabinose ABC transport system, substrate-binding protein	* Thermotoga neapolitana DSM 4359 Site: position = -136 score = 6.18535 sequence = ACAAAAGTACGTACCTTTAT Site: position = -33 score = 4.70179 sequence = CAACTGGTACGTACCGATAT Gene: CTN_0408: Predicted arabinosides or arabinose ABC transport system, substrate-binding protein	2 Thermotoga petrophila RKU-1* Site: position = -150 score = 6.51559 sequence = ATAAAAGTACGTACCTTTAT Site: position = -48 score = 4.7066 sequence = CCATCGGTACGTACCGTTAT Gene: Tpet_0647: Predicted arabinosides or arabinose ABC transport system, substrate-binding protein Gene: Tpet_0646: Predicted arabinosides or arabinose ABC transport system, substrate-binding protein	* Thermotoga naphthophila RKU-10 Site: position = -150 score = 6.51559 sequence = ATAAAAGTACGTACCTTTAT Site: position = -48 score = 4.7066 sequence = CCATCGGTACGTACCGTTAT Gene: Tnap_0907: Predicted arabinosides or arabinose ABC transport system, substrate-binding protein	Thermotoga lettingae TMO	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	Predicted arabinosides or arabinose ABC transport system, substrate-binding protein
araF	* Thermotoga maritima MSB8 Site: position = -1396 score = 4.7066 sequence = ccAtcGGTACGTACCgTTAT Site: position = -1498 score = 6.28709 sequence = ATAAAaGTACGTACCaTTAT Gene: TM0278: Predicted arabinosides or arabinose ABC transport system, permease protein 1	Thermotoga sp. RQ2 Gene: TRQ2_0670: Predicted arabinosides or arabinose ABC transport system, permease protein 1	Thermotoga neapolitana DSM 4359 Gene: CTN_0406: Predicted arabinosides or arabinose ABC transport system, permease protein 1	Thermotoga petrophila RKU-1 Gene: Tpet_0645: Predicted arabinosides or arabinose ABC transport system, permease protein 1	Thermotoga naphthophila RKU-10	Thermotoga lettingae TMO	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	Predicted arabinosides or arabinose ABC transport system, permease protein 1
araG	Thermotoga maritima MSB8 Gene: TM0279: Predicted arabinosides or arabinose ABC transport system, permease protein 2	Thermotoga sp. RQ2 Gene: TRQ2_0669: Predicted arabinosides or arabinose ABC transport system, permease protein 2	Thermotoga neapolitana DSM 4359 Gene: CTN_0405: Predicted arabinosides or arabinose ABC transport system, permease protein 2	Thermotoga petrophila RKU-1 Gene: Tpet_0644: Predicted arabinosides or arabinose ABC transport system, permease protein 2	Thermotoga naphthophila RKU-10 Gene: Tnap_0909: Predicted arabinosides or arabinose ABC transport system, permease protein 2	Thermotoga lettingae TMO	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	Predicted arabinosides or arabinose ABC transport system, permease protein 2

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog AraR - Thermotogales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --