Regulog AraR - Thermotogales
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Arabinose utilization |
| Effector: | Arabinose |
| Phylum: | Thermotogae |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Thermotogales
- By trascription factor - AraR
- By TF family - GntR/Others
- By effector - Arabinose
- By pathway - Arabinose utilization
| Genome | Genes | Operons |
|---|---|---|
| Thermotoga maritima MSB8 | 9 | 3 |
| Thermotoga sp. RQ2 | 21 | 5 |
| Thermotoga neapolitana DSM 4359 | 3 | 2 |
| Thermotoga petrophila RKU-1 | 22 | 5 |
| Thermotoga naphthophila RKU-10 | 10 | 3 |
| Thermotoga lettingae TMO | 10 | 2 |
| Thermosipho africanus TCF52B | ||
| Thermosipho melanesiensis BI429 | ||
| Fervidobacterium nodosum Rt17-B1 | ||
| Petrotoga mobilis SJ95 | ||
| Thermotogales bacterium TBF 19.5.1 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| araN-II |
|
*
Thermotoga sp. RQ2 Site: position = -50 score = 5.74643 sequence = AAATTGGTACGTACCTATCT Site: position = -233 score = 5.35162 sequence = CATTTTGTACGTACATATAT Gene: TRQ2_0661: Predicted arabinose ABC transporter, substrate binding protein |
|
*
Thermotoga petrophila RKU-1 Site: position = -233 score = 5.35162 sequence = CATTTTGTACGTACATATAT Site: position = -50 score = 5.74643 sequence = AAATTGGTACGTACCTATCT Gene: Tpet_0636: Predicted arabinose ABC transporter, substrate binding protein |
|
*
Thermotoga lettingae TMO Site: position = -169 score = 4.99913 sequence = TAATTTGTATGTACATATAT Gene: Tlet_1143: Predicted arabinose ABC transporter, substrate binding protein |
|
|
|
|
|
Predicted arabinose ABC transporter, substrate binding protein |
| araP-II |
|
Gene: TRQ2_0660: Alpha-arabinosides ABC transport system, permease protein 1 |
|
Gene: Tpet_0635: Alpha-arabinosides ABC transport system, permease protein 1 |
|
Gene: Tlet_1144: Alpha-arabinosides ABC transport system, permease protein 1 |
|
|
|
|
|
Alpha-arabinosides ABC transport system, permease protein 1 |
| araQ-II |
|
Gene: TRQ2_0659: Alpha-arabinosides ABC transport system, permease protein 2 |
|
Gene: Tpet_0634: Alpha-arabinosides ABC transport system, permease protein 2 |
|
Gene: Tlet_1145: Alpha-arabinosides ABC transport system, permease protein 2 |
|
|
|
|
|
Alpha-arabinosides ABC transport system, permease protein 2 |
| abf3 |
|
Gene: TRQ2_0658: Alpha-N-arabinofuranosidase II (EC 3.2.1.55) |
|
Gene: Tpet_0633: Alpha-N-arabinofuranosidase II (EC 3.2.1.55) |
|
Gene: Tlet_1147: Alpha-N-arabinofuranosidase II (EC 3.2.1.55) |
|
|
|
|
|
Alpha-N-arabinofuranosidase II (EC 3.2.1.55) |
| xylX |
|
Gene: TRQ2_0657: Secreted glycosyl hydrolase, similar to xylosidase |
|
Gene: Tpet_0632: Secreted glycosyl hydrolase, similar to xylosidase |
|
|
|
|
|
|
|
Secreted glycosyl hydrolase, similar to xylosidase |
| abfA |
Gene: TM0281: Alpha-N-arabinofuranosidase (EC 3.2.1.55) |
Gene: TRQ2_0656: Alpha-N-arabinofuranosidase (EC 3.2.1.55) |
Gene: CTN_0403: Alpha-N-arabinofuranosidase (EC 3.2.1.55) |
Gene: Tpet_0631: Alpha-N-arabinofuranosidase (EC 3.2.1.55) |
Gene: Tnap_0911: Alpha-N-arabinofuranosidase (EC 3.2.1.55) |
Gene: Tlet_1148: Alpha-N-arabinofuranosidase (EC 3.2.1.55) |
|
|
|
|
|
Alpha-N-arabinofuranosidase (EC 3.2.1.55) |
| araM |
Gene: TM0282: L-arabinose-specific 1-epimerase (mutarotase) |
Gene: TRQ2_0655: L-arabinose-specific 1-epimerase (mutarotase) |
Gene: CTN_0402: L-arabinose-specific 1-epimerase (mutarotase) |
Gene: Tpet_0630: L-arabinose-specific 1-epimerase (mutarotase) |
Gene: Tnap_0912: L-arabinose-specific 1-epimerase (mutarotase) |
|
|
|
|
|
|
L-arabinose-specific 1-epimerase (mutarotase) |
| araD |
Gene: TM0283: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4) |
Gene: TRQ2_0654: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4) |
Gene: CTN_0401: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4) |
Gene: Tpet_0629: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4) |
Gene: Tnap_0915: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4) |
Gene: Tlet_1139: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4) |
|
|
|
|
|
L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4) |
| araB |
Gene: TM0284: Ribulokinase (EC 2.7.1.16) |
Gene: TRQ2_0653: Ribulokinase (EC 2.7.1.16) |
Gene: CTN_0400: Ribulokinase (EC 2.7.1.16) |
Gene: Tpet_0628: Ribulokinase (EC 2.7.1.16) |
Gene: Tnap_0916: Ribulokinase (EC 2.7.1.16) |
Gene: Tlet_1150: Ribulokinase (EC 2.7.1.16) |
|
|
|
|
|
Ribulokinase (EC 2.7.1.16) |
| araW |
Gene: TM0285: Predicted glycerol-1-phosphate dehydrogenase, arabinose operon |
Gene: TRQ2_0652: Predicted glycerol-1-phosphate dehydrogenase, arabinose operon |
Gene: CTN_0399: Predicted glycerol-1-phosphate dehydrogenase, arabinose operon |
Gene: Tpet_0627: Predicted glycerol-1-phosphate dehydrogenase, arabinose operon |
Gene: Tnap_0917: Predicted glycerol-1-phosphate dehydrogenase, arabinose operon |
|
|
|
|
|
|
Predicted glycerol-1-phosphate dehydrogenase, arabinose operon |
| xynB |
|
|
|
|
|
Gene: Tlet_1146: Endo-1,4-beta-xylanase |
|
|
|
|
|
Endo-1,4-beta-xylanase |
| araA-II |
|
|
|
|
|
Gene: Tlet_1149: Predicted L-arabinose isomerase (EC 5.3.1.4) |
|
|
|
|
|
Predicted L-arabinose isomerase (EC 5.3.1.4) |
| glsA |
*
Thermotoga maritima MSB8 Site: position = -44 score = 5.93951 sequence = AATAATGTACGTACCTAAAT Gene: TM0280: Putative glycosyl hydrolase of unknown function (DUF1680) |
*
Thermotoga sp. RQ2 Site: position = -58 score = 5.93951 sequence = AATAATGTACGTACCTAAAT Gene: TRQ2_0668: Putative glycosyl hydrolase of unknown function (DUF1680) |
Gene: CTN_0404: Putative glycosyl hydrolase of unknown function (DUF1680) |
*
Thermotoga petrophila RKU-1 Site: position = -55 score = 5.03261 sequence = GATAATATACGTACCTAAAT Gene: Tpet_0643: Putative glycosyl hydrolase of unknown function (DUF1680) |
*
Thermotoga naphthophila RKU-10 Site: position = -55 score = 5.03261 sequence = GATAATATACGTACCTAAAT Gene: Tnap_0910: Putative glycosyl hydrolase of unknown function (DUF1680) |
|
|
|
|
|
|
Putative glycosyl hydrolase of unknown function (DUF1680) |
| Tnap_0913 |
|
|
|
|
*
Thermotoga naphthophila RKU-10 Site: position = -56 score = 4.89355 sequence = TATAATGTACGTACCTATCA Gene: Tnap_0913: predicted arabinose ABC transporter, sugar-binding protein |
|
|
|
|
|
|
predicted arabinose ABC transporter, sugar-binding protein |
| Tnap_0914 |
|
|
|
|
Gene: Tnap_0914: predicted arabinose ABC transporter, permease component |
|
|
|
|
|
|
predicted arabinose ABC transporter, permease component |
| araR |
Gene: TM0275: Transcriptional repressor of arabinoside utilization operon, GntR family |
Gene: TRQ2_0673: Transcriptional repressor of arabinoside utilization operon, GntR family |
Gene: CTN_0410: Transcriptional repressor of arabinoside utilization operon, GntR family |
Gene: Tpet_0649: Transcriptional repressor of arabinoside utilization operon, GntR family |
Gene: Tnap_0905: Transcriptional repressor of arabinoside utilization operon, GntR family |
*
Thermotoga lettingae TMO Site: position = 27 score = 5.34936 sequence = ATTTATGTACGTACGTTTAC Gene: Tlet_1138: Transcriptional repressor of arabinoside utilization operon, GntR family |
|
|
|
|
|
Transcriptional repressor of arabinoside utilization operon, GntR family |
| CRON 2. | ||||||||||||
| araA |
*
Thermotoga maritima MSB8 Site: position = -164 score = 4.7066 sequence = ATAACGGTACGTACCGATGG Site: position = -62 score = 6.28709 sequence = ATAATGGTACGTACTTTTAT Gene: TM0276: L-arabinose isomerase (EC 5.3.1.4) |
*
Thermotoga sp. RQ2 Site: position = -62 score = 6.51559 sequence = ATAAAGGTACGTACTTTTAT Site: position = -164 score = 4.7066 sequence = ATAACGGTACGTACCGATGG Gene: TRQ2_0672: L-arabinose isomerase (EC 5.3.1.4) |
*
Thermotoga neapolitana DSM 4359 Site: position = -62 score = 6.18535 sequence = ATAAAGGTACGTACTTTTGT Site: position = -165 score = 4.70179 sequence = ATATCGGTACGTACCAGTTG Gene: CTN_0409: L-arabinose isomerase (EC 5.3.1.4) |
*
Thermotoga petrophila RKU-1 Site: position = -62 score = 6.51559 sequence = ATAAAGGTACGTACTTTTAT Site: position = -164 score = 4.7066 sequence = ATAACGGTACGTACCGATGG Gene: Tpet_0648: L-arabinose isomerase (EC 5.3.1.4) |
*
Thermotoga naphthophila RKU-10 Site: position = -62 score = 6.51559 sequence = ATAAAGGTACGTACTTTTAT Site: position = -164 score = 4.7066 sequence = ATAACGGTACGTACCGATGG Gene: Tnap_0906: L-arabinose isomerase (EC 5.3.1.4) |
|
|
|
|
|
|
L-arabinose isomerase (EC 5.3.1.4) |
| CRON 3. | ||||||||||||
| abf6 |
|
*2
Thermotoga sp. RQ2 Site: position = -221 score = 5.74643 sequence = AGATAGGTACGTACCAATTT Site: position = -38 score = 5.35162 sequence = ATATATGTACGTACAAAATG Gene: TRQ2_0662: Predicted Aapha-N-arabinofuranosidase (EC 3.2.1.55) Gene: TRQ2_0664: Predicted Aapha-N-arabinofuranosidase (EC 3.2.1.55) |
|
*2
Thermotoga petrophila RKU-1 Site: position = -221 score = 5.74643 sequence = AGATAGGTACGTACCAATTT Site: position = -38 score = 5.35162 sequence = ATATATGTACGTACAAAATG Gene: Tpet_0637: Predicted Aapha-N-arabinofuranosidase (EC 3.2.1.55) Gene: Tpet_0639: Predicted Aapha-N-arabinofuranosidase (EC 3.2.1.55) |
|
|
|
|
|
|
|
Predicted Aapha-N-arabinofuranosidase (EC 3.2.1.55) |
| lamG1 |
|
Gene: TRQ2_0663: Laminin G domain-containing protein |
|
Gene: Tpet_0638: Laminin G domain-containing protein |
|
|
|
|
|
|
|
Laminin G domain-containing protein |
| conA1 |
|
Gene: TRQ2_0665: Con A-like domain-containing protein |
|
Gene: Tpet_0640: Con A-like domain-containing protein |
|
|
|
|
|
|
|
Con A-like domain-containing protein |
| conA2 |
|
Gene: TRQ2_0666: Con A-like domain-containing protein |
|
Gene: Tpet_0641: Con A-like domain-containing protein |
|
|
|
|
|
|
|
Con A-like domain-containing protein |
| lamG2 |
|
Gene: TRQ2_0667: Laminin G domain-containing protein |
|
Gene: Tpet_0642: Laminin G domain-containing protein |
|
|
|
|
|
|
|
Laminin G domain-containing protein |
| CRON 4. | ||||||||||||
| araE |
|
*
Thermotoga sp. RQ2 Site: position = -150 score = 6.51559 sequence = ATAAAAGTACGTACCTTTAT Site: position = -48 score = 4.7066 sequence = CCATCGGTACGTACCGTTAT Gene: TRQ2_0671: Predicted arabinosides or arabinose ABC transport system, substrate-binding protein |
*
Thermotoga neapolitana DSM 4359 Site: position = -136 score = 6.18535 sequence = ACAAAAGTACGTACCTTTAT Site: position = -33 score = 4.70179 sequence = CAACTGGTACGTACCGATAT Gene: CTN_0408: Predicted arabinosides or arabinose ABC transport system, substrate-binding protein |
*2
Thermotoga petrophila RKU-1 Site: position = -150 score = 6.51559 sequence = ATAAAAGTACGTACCTTTAT Site: position = -48 score = 4.7066 sequence = CCATCGGTACGTACCGTTAT Gene: Tpet_0647: Predicted arabinosides or arabinose ABC transport system, substrate-binding protein Gene: Tpet_0646: Predicted arabinosides or arabinose ABC transport system, substrate-binding protein |
*
Thermotoga naphthophila RKU-10 Site: position = -150 score = 6.51559 sequence = ATAAAAGTACGTACCTTTAT Site: position = -48 score = 4.7066 sequence = CCATCGGTACGTACCGTTAT Gene: Tnap_0907: Predicted arabinosides or arabinose ABC transport system, substrate-binding protein |
|
|
|
|
|
|
Predicted arabinosides or arabinose ABC transport system, substrate-binding protein |
| araF |
*
Thermotoga maritima MSB8 Site: position = -1396 score = 4.7066 sequence = ccAtcGGTACGTACCgTTAT Site: position = -1498 score = 6.28709 sequence = ATAAAaGTACGTACCaTTAT Gene: TM0278: Predicted arabinosides or arabinose ABC transport system, permease protein 1 |
Gene: TRQ2_0670: Predicted arabinosides or arabinose ABC transport system, permease protein 1 |
Gene: CTN_0406: Predicted arabinosides or arabinose ABC transport system, permease protein 1 |
Gene: Tpet_0645: Predicted arabinosides or arabinose ABC transport system, permease protein 1 |
|
|
|
|
|
|
|
Predicted arabinosides or arabinose ABC transport system, permease protein 1 |
| araG |
Gene: TM0279: Predicted arabinosides or arabinose ABC transport system, permease protein 2 |
Gene: TRQ2_0669: Predicted arabinosides or arabinose ABC transport system, permease protein 2 |
Gene: CTN_0405: Predicted arabinosides or arabinose ABC transport system, permease protein 2 |
Gene: Tpet_0644: Predicted arabinosides or arabinose ABC transport system, permease protein 2 |
Gene: Tnap_0909: Predicted arabinosides or arabinose ABC transport system, permease protein 2 |
|
|
|
|
|
|
Predicted arabinosides or arabinose ABC transport system, permease protein 2 |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |