Regulon of AraR in Thermotoga maritima MSB8

Properties
Regulator type:	Transcription factor
TF locus tag:	TM0275
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Arabinose utilization
Effector:	Arabinose
Regulog:	AraR - Thermotogales
Statistics of regulated genes:
- Genes	9
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 35 sites [see more]

Member of regulog collections

By taxonomy - Thermotogales
By trascription factor - AraR
By TF family - GntR/Others
By effector - Arabinose
By pathway - Arabinose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -1498 Score: 6.3 Sequence: ATAAAaGTACGTACCaTTAT Position: -1396 Score: 4.7 Sequence: ccAtcGGTACGTACCgTTAT Locus tag: TM0278 Name: araF Funciton: Predicted arabinosides or arabinose ABC transport system, permease protein 1 Locus tag: TM0279 Name: araG Funciton: Predicted arabinosides or arabinose ABC transport system, permease protein 2
	TM0278	araF	Predicted arabinosides or arabinose ABC transport system, permease protein 1
	TM0279	araG	Predicted arabinosides or arabinose ABC transport system, permease protein 2
Position: -44 Score: 5.9 Sequence: AATAATGTACGTACCTAAAT Locus tag: TM0280 Name: glsA Funciton: Putative glycosyl hydrolase of unknown function (DUF1680) Locus tag: TM0281 Name: abfA Funciton: Alpha-N-arabinofuranosidase (EC 3.2.1.55) Locus tag: TM0282 Name: araM Funciton: L-arabinose-specific 1-epimerase (mutarotase) Locus tag: TM0283 Name: araD Funciton: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4) Locus tag: TM0284 Name: araB Funciton: Ribulokinase (EC 2.7.1.16) Locus tag: TM0285 Name: araW Funciton: Predicted glycerol-1-phosphate dehydrogenase, arabinose operon
	TM0280	glsA	Putative glycosyl hydrolase of unknown function (DUF1680)
	TM0281	abfA	Alpha-N-arabinofuranosidase (EC 3.2.1.55)
	TM0282	araM	L-arabinose-specific 1-epimerase (mutarotase)
	TM0283	araD	L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
	TM0284	araB	Ribulokinase (EC 2.7.1.16)
	TM0285	araW	Predicted glycerol-1-phosphate dehydrogenase, arabinose operon
Position: -164 Score: 4.7 Sequence: ATAACGGTACGTACCGATGG Position: -62 Score: 6.3 Sequence: ATAATGGTACGTACTTTTAT Locus tag: TM0276 Name: araA Funciton: L-arabinose isomerase (EC 5.3.1.4)
	TM0276	araA	L-arabinose isomerase (EC 5.3.1.4)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD