Regulon of AraR in Thermotoga lettingae TMO

Properties
Regulator type:	Transcription factor
TF locus tag:	Tlet_1138
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Arabinose utilization
Effector:	Arabinose
Regulog:	AraR - Thermotogales
Statistics of regulated genes:
- Genes	10
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 35 sites [see more]

Member of regulog collections

By taxonomy - Thermotogales
By trascription factor - AraR
By TF family - GntR/Others
By effector - Arabinose
By pathway - Arabinose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -169 Score: 5 Sequence: TAATTTGTATGTACATATAT Locus tag: Tlet_1143 Name: araN-II Funciton: Predicted arabinose ABC transporter, substrate binding protein Locus tag: Tlet_1144 Name: araP-II Funciton: Alpha-arabinosides ABC transport system, permease protein 1 Locus tag: Tlet_1145 Name: araQ-II Funciton: Alpha-arabinosides ABC transport system, permease protein 2 Locus tag: Tlet_1146 Name: xynB Funciton: Endo-1,4-beta-xylanase Locus tag: Tlet_1147 Name: abf3 Funciton: Alpha-N-arabinofuranosidase II (EC 3.2.1.55) Locus tag: Tlet_1148 Name: abfA Funciton: Alpha-N-arabinofuranosidase (EC 3.2.1.55) Locus tag: Tlet_1149 Name: araA-II Funciton: Predicted L-arabinose isomerase (EC 5.3.1.4) Locus tag: Tlet_1150 Name: araB Funciton: Ribulokinase (EC 2.7.1.16)
	Tlet_1143	araN-II	Predicted arabinose ABC transporter, substrate binding protein
	Tlet_1144	araP-II	Alpha-arabinosides ABC transport system, permease protein 1
	Tlet_1145	araQ-II	Alpha-arabinosides ABC transport system, permease protein 2
	Tlet_1146	xynB	Endo-1,4-beta-xylanase
	Tlet_1147	abf3	Alpha-N-arabinofuranosidase II (EC 3.2.1.55)
	Tlet_1148	abfA	Alpha-N-arabinofuranosidase (EC 3.2.1.55)
	Tlet_1149	araA-II	Predicted L-arabinose isomerase (EC 5.3.1.4)
	Tlet_1150	araB	Ribulokinase (EC 2.7.1.16)
Position: 27 Score: 5.3 Sequence: ATTTATGTACGTACGTTTAC Locus tag: Tlet_1138 Name: araR Funciton: Transcriptional repressor of arabinoside utilization operon, GntR family Locus tag: Tlet_1139 Name: araD Funciton: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
	Tlet_1138	araR	Transcriptional repressor of arabinoside utilization operon, GntR family
	Tlet_1139	araD	L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD