Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing xynB gene

Properties
Regulog: AraR - Thermotogales
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Arabinose utilization
Effector: Arabinose
Phylum: Thermotogae
Built upon 35 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Thermotoga lettingae TMO
Position: -169
Score: 4.99913
Sequence: TAATTTGTATGTACATATAT
Locus tag: Tlet_1143
Name: araN-II
Funciton: Predicted arabinose ABC transporter, substrate binding protein
Locus tag: Tlet_1144
Name: araP-II
Funciton: Alpha-arabinosides ABC transport system, permease protein 1
Locus tag: Tlet_1145
Name: araQ-II
Funciton: Alpha-arabinosides ABC transport system, permease protein 2
Locus tag: Tlet_1146
Name: xynB
Funciton: Endo-1,4-beta-xylanase
Locus tag: Tlet_1147
Name: abf3
Funciton: Alpha-N-arabinofuranosidase II (EC 3.2.1.55)
Locus tag: Tlet_1148
Name: abfA
Funciton: Alpha-N-arabinofuranosidase (EC 3.2.1.55)
Locus tag: Tlet_1149
Name: araA-II
Funciton: Predicted L-arabinose isomerase (EC 5.3.1.4)
Locus tag: Tlet_1150
Name: araB
Funciton: Ribulokinase (EC 2.7.1.16)
araN-II-araP-II-araQ-II-xynB-abf3-abfA-araA-II-araB -169 5 TAATTTGTATGTACATATAT Tlet_1143
© 2009-2020 RegPrecise