Regulon of AraR in Thermotoga naphthophila RKU-10

Properties
Regulator type:	Transcription factor
TF locus tag:	Tnap_0905
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Arabinose utilization
Effector:	Arabinose
Regulog:	AraR - Thermotogales
Statistics of regulated genes:
- Genes	10
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 35 sites [see more]

Member of regulog collections

By taxonomy - Thermotogales
By trascription factor - AraR
By TF family - GntR/Others
By effector - Arabinose
By pathway - Arabinose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -150 Score: 6.5 Sequence: ATAAAAGTACGTACCTTTAT Position: -48 Score: 4.7 Sequence: CCATCGGTACGTACCGTTAT Locus tag: Tnap_0907 Name: araE Funciton: Predicted arabinosides or arabinose ABC transport system, substrate-binding protein
	Tnap_0907	araE	Predicted arabinosides or arabinose ABC transport system, substrate-binding protein
Position: -164 Score: 4.7 Sequence: ATAACGGTACGTACCGATGG Position: -62 Score: 6.5 Sequence: ATAAAGGTACGTACTTTTAT Locus tag: Tnap_0906 Name: araA Funciton: L-arabinose isomerase (EC 5.3.1.4)
	Tnap_0906	araA	L-arabinose isomerase (EC 5.3.1.4)
Position: -56 Score: 4.9 Sequence: TATAATGTACGTACCTATCA Position: -55 Score: 5 Sequence: GATAATATACGTACCTAAAT Locus tag: Tnap_0910 Name: glsA Funciton: Putative glycosyl hydrolase of unknown function (DUF1680) Locus tag: Tnap_0911 Name: abfA Funciton: Alpha-N-arabinofuranosidase (EC 3.2.1.55) Locus tag: Tnap_0912 Name: araM Funciton: L-arabinose-specific 1-epimerase (mutarotase) Locus tag: Tnap_0913 Name: Tnap_0913 Funciton: predicted arabinose ABC transporter, sugar-binding protein Locus tag: Tnap_0914 Name: Tnap_0914 Funciton: predicted arabinose ABC transporter, permease component Locus tag: Tnap_0915 Name: araD Funciton: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4) Locus tag: Tnap_0916 Name: araB Funciton: Ribulokinase (EC 2.7.1.16) Locus tag: Tnap_0917 Name: araW Funciton: Predicted glycerol-1-phosphate dehydrogenase, arabinose operon
	Tnap_0910	glsA	Putative glycosyl hydrolase of unknown function (DUF1680)
	Tnap_0911	abfA	Alpha-N-arabinofuranosidase (EC 3.2.1.55)
	Tnap_0912	araM	L-arabinose-specific 1-epimerase (mutarotase)
	Tnap_0913	Tnap_0913	predicted arabinose ABC transporter, sugar-binding protein
	Tnap_0914	Tnap_0914	predicted arabinose ABC transporter, permease component
	Tnap_0915	araD	L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
	Tnap_0916	araB	Ribulokinase (EC 2.7.1.16)
	Tnap_0917	araW	Predicted glycerol-1-phosphate dehydrogenase, arabinose operon

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD