Statistics of regulated genes

Genome	Genes	Operons
Staphylococcus aureus subsp. aureus N315	21	12
Staphylococcus capitis SK14	20	9
Staphylococcus epidermidis ATCC 12228	21	10
Staphylococcus carnosus subsp. carnosus TM300	16	9
Staphylococcus haemolyticus JCSC1435	17	8
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305	23	10
Macrococcus caseolyticus JCSC5402	10	6

Clusters of co-Regulated Orthologous operoNs (CRONs)

Genes								Function
CRON 1.
tcyP	* Staphylococcus aureus subsp. aureus N315 Site: position = -54 score = 5.7921 sequence = TTATTCTTAGCATACTAGTCGGAATTA Gene: SA0368: L-cystine uptake protein tcyP	* Staphylococcus capitis SK14 Site: position = -57 score = 5.09002 sequence = ATATCCTTATTATATATGTCGGAATAC Gene: STACA0001_1450: L-cystine uptake protein tcyP	* Staphylococcus epidermidis ATCC 12228 Site: position = -56 score = 5.29314 sequence = TTATTCTTATTACATATGTCGGAATAC Gene: SE2354: L-cystine uptake protein tcyP	* Staphylococcus carnosus subsp. carnosus TM300 Site: position = -269 score = 5.03927 sequence = TAAATACGATATATTTACTAAGGATTT Site: position = -151 score = 4.29571 sequence = TTTTACCTACATAACTACTATTTAAAA Gene: Sca_0042: L-cystine uptake protein tcyP	* Staphylococcus haemolyticus JCSC1435 Site: position = -49 score = 5.41275 sequence = TTATCCTTATTAAGTATGTCGGAATTA Gene: SH2589: L-cystine uptake protein tcyP	* Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 Site: position = -63 score = 4.61715 sequence = ATATCCTTAGTATACGTATCGGATTTC Gene: SSP2329: L-cystine uptake protein tcyP	* Macrococcus caseolyticus JCSC5402 Site: position = 32 score = 5.53366 sequence = TAATTCTTAgTAtTcTtATAGGAtTac Gene: MCCL_0267: L-cystine uptake protein tcyP	L-cystine uptake protein tcyP
CRON 2.
tcyA	* Staphylococcus aureus subsp. aureus N315 Site: position = -40 score = 6.18547 sequence = TTATTCCGATTAGAATAATAAGAATAA Gene: SA2202: L-cystine uptake ABC transporter, L-cystine-binding protein TcyA	* Staphylococcus capitis SK14 Site: position = -40 score = 6.04113 sequence = TTATTCCGATTAGAATAATAAGATTAA Gene: STACA0001_1063: L-cystine uptake ABC transporter, L-cystine-binding protein TcyA	* Staphylococcus epidermidis ATCC 12228 Site: position = -40 score = 6.18547 sequence = TTATTCCGATTAGAATAATAAGAATAA Gene: SE1993: L-cystine uptake ABC transporter, L-cystine-binding protein TcyA	* Staphylococcus carnosus subsp. carnosus TM300 Site: position = -40 score = 5.35489 sequence = TTATTCCGATGAGAATGATAAGGATAA Gene: Sca_1910: L-cystine uptake ABC transporter, L-cystine-binding protein TcyA	* Staphylococcus haemolyticus JCSC1435 Site: position = -41 score = 5.90865 sequence = TTATTCTGACTAATCTAATAGGAATAT Gene: SH0639: L-cystine uptake ABC transporter, L-cystine-binding protein TcyA	* Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 Site: position = -37 score = 5.81712 sequence = TTATTCCGATAAGAATAATAAGAATAG Gene: SSP0242: L-cystine uptake ABC transporter, L-cystine-binding protein TcyA	* Macrococcus caseolyticus JCSC5402 Site: position = -38 score = 5.25548 sequence = CTATTCCGAGTAAATTGATATGAATAG Gene: MCCL_1425: L-cystine uptake ABC transporter, L-cystine-binding protein TcyA	L-cystine uptake ABC transporter, L-cystine-binding protein TcyA
tcyB	Staphylococcus aureus subsp. aureus N315 Gene: SA2201: L-cystine uptake ABC transporter, permease protein TcyB	Staphylococcus capitis SK14 Gene: STACA0001_1064: L-cystine uptake ABC transporter, permease protein TcyB	Staphylococcus epidermidis ATCC 12228 Gene: SE1992: L-cystine uptake ABC transporter, permease protein TcyB	Staphylococcus carnosus subsp. carnosus TM300 Gene: Sca_1909: L-cystine uptake ABC transporter, permease protein TcyB	Staphylococcus haemolyticus JCSC1435 Gene: SH0640: L-cystine uptake ABC transporter, permease protein TcyB	Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 Gene: SSP0243: L-cystine uptake ABC transporter, permease protein TcyB	Macrococcus caseolyticus JCSC5402 Gene: MCCL_1424: L-cystine uptake ABC transporter, permease protein TcyB	L-cystine uptake ABC transporter, permease protein TcyB
tcyC	Staphylococcus aureus subsp. aureus N315 Gene: SA2200: L-cystine uptake ABC transporter, ATP-binding protein TcyC	Staphylococcus capitis SK14 Gene: STACA0001_1065: L-cystine uptake ABC transporter, ATP-binding protein TcyC	Staphylococcus epidermidis ATCC 12228 Gene: SE1991: L-cystine uptake ABC transporter, ATP-binding protein TcyC	Staphylococcus carnosus subsp. carnosus TM300 Gene: Sca_1908: L-cystine uptake ABC transporter, ATP-binding protein TcyC	Staphylococcus haemolyticus JCSC1435 Gene: SH0641: L-cystine uptake ABC transporter, ATP-binding protein TcyC	Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 Gene: SSP0244: L-cystine uptake ABC transporter, ATP-binding protein TcyC	Macrococcus caseolyticus JCSC5402 Gene: MCCL_1423: L-cystine uptake ABC transporter, ATP-binding protein TcyC	L-cystine uptake ABC transporter, ATP-binding protein TcyC
CRON 3.
ssuB	* Staphylococcus aureus subsp. aureus N315 Site: position = -41 score = 6.02987 sequence = TAATTCCTATTAAAATAGTAGGGATTA Gene: SA0166: sulfonate ABC transporter, ATPase component	Staphylococcus capitis SK14	Staphylococcus epidermidis ATCC 12228	Staphylococcus carnosus subsp. carnosus TM300	Staphylococcus haemolyticus JCSC1435	* Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 Site: position = -41 score = 5.71783 sequence = CAATTCTTATTAAAACGATAAGAATAA Gene: SSP0459: sulfonate ABC transporter, ATPase component	Macrococcus caseolyticus JCSC5402	sulfonate ABC transporter, ATPase component
ssuA	Staphylococcus aureus subsp. aureus N315 Gene: SA0167: sulfonate ABC transporter, substrate-binding component	Staphylococcus capitis SK14	Staphylococcus epidermidis ATCC 12228	Staphylococcus carnosus subsp. carnosus TM300	Staphylococcus haemolyticus JCSC1435	Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 Gene: SSP0458: sulfonate ABC transporter, substrate-binding component	Macrococcus caseolyticus JCSC5402	sulfonate ABC transporter, substrate-binding component
ssuC	Staphylococcus aureus subsp. aureus N315 Gene: SA0168: sulfonate ABC transporter, permease component	Staphylococcus capitis SK14	Staphylococcus epidermidis ATCC 12228	Staphylococcus carnosus subsp. carnosus TM300	Staphylococcus haemolyticus JCSC1435	Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 Gene: SSP0457: sulfonate ABC transporter, permease component	Macrococcus caseolyticus JCSC5402	sulfonate ABC transporter, permease component
SA0169	Staphylococcus aureus subsp. aureus N315 Gene: SA0169: putative acyl-CoA dehydrogenase	Staphylococcus capitis SK14	Staphylococcus epidermidis ATCC 12228	Staphylococcus carnosus subsp. carnosus TM300	Staphylococcus haemolyticus JCSC1435	Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 Gene: SSP0456: putative acyl-CoA dehydrogenase	Macrococcus caseolyticus JCSC5402	putative acyl-CoA dehydrogenase
CRON 4.
SA2080	* Staphylococcus aureus subsp. aureus N315 Site: position = -62 score = 4.58556 sequence = TAAAGTCGAGTGTTAAACTAGGAATAA Gene: SA2080: putative acyl-CoA dehydrogenase	* Staphylococcus capitis SK14 Site: position = -57 score = 4.21229 sequence = AAAAGTCGAGTGTTAAACTAGGATTAA Gene: STACA0001_1208: putative acyl-CoA dehydrogenase	* Staphylococcus epidermidis ATCC 12228 Site: position = -65 score = 4.41296 sequence = TAAAGTCGAGTGTTAAACTATGAATAA Gene: SE1858: putative acyl-CoA dehydrogenase	* Staphylococcus carnosus subsp. carnosus TM300 Site: position = -56 score = 4.38511 sequence = TTAATCCGAGTGATACACTAAACTTAA Gene: Sca_1777: putative acyl-CoA dehydrogenase	* Staphylococcus haemolyticus JCSC1435 Site: position = -266 score = 4.35193 sequence = TAATGTCGAGTGATAAACTAGGTTTAA Gene: SH0767: putative acyl-CoA dehydrogenase	* Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 Site: position = -110 score = 5.12883 sequence = TAAATCTTATCGGTAAAGTAAGGATTT Gene: SSP0622: putative acyl-CoA dehydrogenase	* Macrococcus caseolyticus JCSC5402 Site: position = -256 score = 4.54588 sequence = TATTTCCTAGATAATAAATAATGTATT Gene: MCCL_0131: putative acyl-CoA dehydrogenase	putative acyl-CoA dehydrogenase
CRON 5.
SA1850	* Staphylococcus aureus subsp. aureus N315 Site: position = -40 score = 5.17471 sequence = TAATACATACTAAACTTATCGGAAATG Gene: SA1850: putative transporter for thiosulphate	Staphylococcus capitis SK14	* Staphylococcus epidermidis ATCC 12228 Site: position = -35 score = 4.56744 sequence = AATACCTTAGTATTTATATCGGAAAAG Gene: SE1646: putative transporter for thiosulphate	* Staphylococcus carnosus subsp. carnosus TM300 Site: position = -38 score = 4.80801 sequence = TAAAACTTACTAACATTATCGGAAAAG Gene: Sca_1551: putative transporter for thiosulphate	Staphylococcus haemolyticus JCSC1435 Gene: SH0987: putative transporter for thiosulphate	* Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 Site: position = -37 score = 5.12404 sequence = TTAATCTTATTGATTTTATCGGGAAAG Gene: SSP0834: putative transporter for thiosulphate	* Macrococcus caseolyticus JCSC5402 Site: position = -40 score = 5.764 sequence = TATTTCTTACTAAATCTATCGGAATTA Gene: MCCL_0379: putative transporter for thiosulphate	putative transporter for thiosulphate
CRON 6.
SA0198	* Staphylococcus aureus subsp. aureus N315 Site: position = -77 score = 4.77743 sequence = TAATCTTGAGTAGATTACTATGATATA Gene: SA0198: oligopeptide transport ATP-binding protein	Staphylococcus capitis SK14	Staphylococcus epidermidis ATCC 12228	Staphylococcus carnosus subsp. carnosus TM300	Staphylococcus haemolyticus JCSC1435	Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305	Macrococcus caseolyticus JCSC5402	oligopeptide transport ATP-binding protein
CRON 7.
SA0165	* Staphylococcus aureus subsp. aureus N315 Site: position = -59 score = 4.93951 sequence = GTAATCCGATAAGAATTATAGTAATAT Gene: SA0165: hypothetical protein	Staphylococcus capitis SK14	Staphylococcus epidermidis ATCC 12228	Staphylococcus carnosus subsp. carnosus TM300	Staphylococcus haemolyticus JCSC1435	* Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 Site: position = -69 score = 4.79243 sequence = CATATCCTTGTAATCTGATAAGATTTA Gene: SSP0460: hypothetical protein	Macrococcus caseolyticus JCSC5402	hypothetical protein
CRON 8.
metN2	* Staphylococcus aureus subsp. aureus N315 Site: position = -42 score = 5.75824 sequence = TTATTCCTAGTGGATTAATAAGAATTT Gene: SA0420: methionine ABC transporter paralog, ATP-binding protein MetN2	* Staphylococcus capitis SK14 Site: position = -43 score = 5.39689 sequence = ATATTCAGATAAGTATAATCAGAATTG Gene: STACA0001_1483: methionine ABC transporter paralog, ATP-binding protein MetN2	* Staphylococcus epidermidis ATCC 12228 Site: position = -42 score = 5.26907 sequence = ATATTCAGATAATTTTAATCGGAAATT Gene: SE2322: methionine ABC transporter paralog, ATP-binding protein MetN2	Staphylococcus carnosus subsp. carnosus TM300 Gene: Sca_2191: methionine ABC transporter paralog, ATP-binding protein MetN2	Staphylococcus haemolyticus JCSC1435	Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305	Macrococcus caseolyticus JCSC5402 Gene: MCCL_0417: methionine ABC transporter paralog, ATP-binding protein MetN2	methionine ABC transporter paralog, ATP-binding protein MetN2
metP2	Staphylococcus aureus subsp. aureus N315 Gene: SA0421: methionine ABC transporter paralog, permease protein MetP2	Staphylococcus capitis SK14 Gene: STACA0001_1484: methionine ABC transporter paralog, permease protein MetP2	Staphylococcus epidermidis ATCC 12228 Gene: SE2321: methionine ABC transporter paralog, permease protein MetP2	Staphylococcus carnosus subsp. carnosus TM300 Gene: Sca_2190: methionine ABC transporter paralog, permease protein MetP2	Staphylococcus haemolyticus JCSC1435	Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305	Macrococcus caseolyticus JCSC5402 Gene: MCCL_0418: methionine ABC transporter paralog, permease protein MetP2	methionine ABC transporter paralog, permease protein MetP2
metQ2	Staphylococcus aureus subsp. aureus N315 Gene: SA0422: methionine ABC transporter paralog, substrate-binding protein MetQ2	Staphylococcus capitis SK14 Gene: STACA0001_1485: methionine ABC transporter paralog, substrate-binding protein MetQ2	Staphylococcus epidermidis ATCC 12228 Gene: SE2320: methionine ABC transporter paralog, substrate-binding protein MetQ2	Staphylococcus carnosus subsp. carnosus TM300 Gene: Sca_2189: methionine ABC transporter paralog, substrate-binding protein MetQ2	Staphylococcus haemolyticus JCSC1435	Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305	Macrococcus caseolyticus JCSC5402 Gene: MCCL_0419: methionine ABC transporter paralog, substrate-binding protein MetQ2	methionine ABC transporter paralog, substrate-binding protein MetQ2
CRON 9.
mccA	* Staphylococcus aureus subsp. aureus N315 Site: position = -88 score = 5.82057 sequence = TAATTCTTATCTGAAAAGTAAGAATTA Gene: SA0418: cystathionine beta-synthase	* Staphylococcus capitis SK14 Site: position = -96 score = 5.37115 sequence = TAATTCATACCTGATAAGTAAGAATTT Gene: STACA0001_1480: cystathionine beta-synthase	* Staphylococcus epidermidis ATCC 12228 Site: position = -96 score = 5.70436 sequence = TAATTCATATCTGATAAGTAAGAATTA Gene: SE2324: cystathionine beta-synthase	* Staphylococcus carnosus subsp. carnosus TM300 Site: position = -92 score = 5.5993 sequence = TAATCCATATCAGTATAGTAGGAATAA Gene: Sca_0086: cystathionine beta-synthase	* Staphylococcus haemolyticus JCSC1435 Site: position = -109 score = 5.42572 sequence = TAATTCATAGTGATTGAGTAAGAATTA Gene: SH2549: cystathionine beta-synthase	* Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 Site: position = -57 score = 5.03317 sequence = TAATTCTTATCGGTATAGTAAGGTATT Site: position = -144 score = 5.06379 sequence = GTATGCTTACTGAAAAAGTAGGAATTA Gene: SSP0252: cystathionine beta-synthase	* Macrococcus caseolyticus JCSC5402 Site: position = -46 score = 5.58334 sequence = TAATCCCGAGTTATCTGATAAGAATAA Gene: MCCL_1789: cystathionine beta-synthase	cystathionine beta-synthase
mccB	Staphylococcus aureus subsp. aureus N315 Gene: SA0419: cystathionine gamma-lyase	Staphylococcus capitis SK14 Gene: STACA0001_1481: cystathionine gamma-lyase	Staphylococcus epidermidis ATCC 12228 Gene: SE2323: cystathionine gamma-lyase	Staphylococcus carnosus subsp. carnosus TM300 Gene: Sca_0087: cystathionine gamma-lyase	Staphylococcus haemolyticus JCSC1435 Gene: SH2548: cystathionine gamma-lyase	Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 Gene: SSP0253: cystathionine gamma-lyase	Macrococcus caseolyticus JCSC5402 Gene: MCCL_1790: cystathionine gamma-lyase	cystathionine gamma-lyase
luxS	* Staphylococcus aureus subsp. aureus N315 Site: position = -244 score = 4.75591 sequence = GAATTATTACTTATTCTATCGGTTTTA Gene: SA1936: S-ribosylhomocysteinase	* Staphylococcus capitis SK14 Site: position = -193 score = 5.49013 sequence = TAATTATTACTTATTCTATCGGAATAA Gene: STACA0001_0838: S-ribosylhomocysteinase	* Staphylococcus epidermidis ATCC 12228 Site: position = -182 score = 5.57936 sequence = TAATTATTACTTATTTTATCGGATTTA Gene: SE1732: S-ribosylhomocysteinase	* Staphylococcus carnosus subsp. carnosus TM300 Site: position = -110 score = 4.67294 sequence = TTATCCCGAGTAAACTTATCAACTTAA Gene: Sca_1637: S-ribosylhomocysteinase	* Staphylococcus haemolyticus JCSC1435 Site: position = -182 score = 5.57936 sequence = TAATTATTACTTATTTTATCGGATTTA Gene: SH0901: S-ribosylhomocysteinase	* Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 Site: position = -159 score = 5.13983 sequence = TAATTATTACTTATTCTATCGGGTTTA Gene: SSP0751: S-ribosylhomocysteinase	Macrococcus caseolyticus JCSC5402 Gene: MCCL_1791: S-ribosylhomocysteinase	S-ribosylhomocysteinase
CRON 10.
cysK	* Staphylococcus aureus subsp. aureus N315 Site: position = -55 score = 5.08397 sequence = TATATCCGATAAATAAACTAAGATTTC Gene: SA0471: cysteine synthase	* Staphylococcus capitis SK14 Site: position = -57 score = 4.89394 sequence = TATATCCGATAGGAAAACTAAGTTTTA Gene: STACA0001_2088: cysteine synthase	* Staphylococcus epidermidis ATCC 12228 Site: position = -58 score = 4.8227 sequence = TATATCCGATAGAAAAACTAAGTATTG Gene: SE2270: cysteine synthase	* Staphylococcus carnosus subsp. carnosus TM300 Site: position = -143 score = 4.44308 sequence = GATATCCGATGAAATAGCTAAGATATA Gene: Sca_0164: cysteine synthase	* Staphylococcus haemolyticus JCSC1435 Site: position = -56 score = 4.94506 sequence = TATATCCGATAGAAAAACTAAGTTTTA Gene: SH2497: cysteine synthase	* Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 Site: position = -55 score = 5.1095 sequence = TATATCCGATTGAAAAAGTAGGTTTTA Gene: SSP2243: cysteine synthase	* Macrococcus caseolyticus JCSC5402 Site: position = -50 score = 5.36043 sequence = TAAATCCGATAAGCGTAATAAGAATAA Gene: MCCL_1900: cysteine synthase	cysteine synthase
CRON 11.
cysJ	* Staphylococcus aureus subsp. aureus N315 Site: position = -257 score = 4.71125 sequence = TAATAAATAGTAAATAAATAAAAAATA Gene: SA2413: sulfite reductase [NADPH] flavoprotein, alpha-component	* Staphylococcus capitis SK14 Site: position = -246 score = 4.71748 sequence = TAAAGCATAGTATTCCGATAAGATATA Gene: STACA0001_1811: sulfite reductase [NADPH] flavoprotein, alpha-component	* Staphylococcus epidermidis ATCC 12228 Site: position = -273 score = 4.71837 sequence = CAAAACATAGTATTCCGATAAGAAATA Gene: SE2180: sulfite reductase [NADPH] flavoprotein, alpha-component	* Staphylococcus carnosus subsp. carnosus TM300 Site: position = -52 score = 5.94771 sequence = TAATTCCTACTAAAAAACTAAGAATAA Site: position = -134 score = 5.42667 sequence = TAATTCTTAGTAAACCTATTGGAATTA Gene: Sca_0059: sulfite reductase [NADPH] flavoprotein, alpha-component	* Staphylococcus haemolyticus JCSC1435 Site: position = -152 score = 4.51928 sequence = TAAAACATAGTATTCTGATATGTTTTG Gene: SH0414: sulfite reductase [NADPH] flavoprotein, alpha-component	* Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 Site: position = -152 score = 4.52675 sequence = AATAACCTAGTATTCGTATCGGAAATA Site: position = -58 score = 4.58672 sequence = TTAAACCTATTTAGACAATAATTATAA Gene: SSP2408: sulfite reductase [NADPH] flavoprotein, alpha-component	Macrococcus caseolyticus JCSC5402	sulfite reductase [NADPH] flavoprotein, alpha-component
cysI	Staphylococcus aureus subsp. aureus N315	Staphylococcus capitis SK14 Gene: STACA0001_1810: sulfite reductase (NADPH) hemoprotein, beta-component	Staphylococcus epidermidis ATCC 12228 Gene: SE2179: sulfite reductase (NADPH) hemoprotein, beta-component	Staphylococcus carnosus subsp. carnosus TM300 Gene: Sca_0060: sulfite reductase (NADPH) hemoprotein, beta-component	Staphylococcus haemolyticus JCSC1435 Gene: SH0415: sulfite reductase (NADPH) hemoprotein, beta-component	Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 Gene: SSP2407: sulfite reductase (NADPH) hemoprotein, beta-component	Macrococcus caseolyticus JCSC5402	sulfite reductase (NADPH) hemoprotein, beta-component
cysG	Staphylococcus aureus subsp. aureus N315	Staphylococcus capitis SK14 Gene: STACA0001_1809: uroporphyrin-III C-methyltransferase	Staphylococcus epidermidis ATCC 12228 Gene: SE2178: uroporphyrin-III C-methyltransferase	Staphylococcus carnosus subsp. carnosus TM300 Gene: Sca_0061: uroporphyrin-III C-methyltransferase	Staphylococcus haemolyticus JCSC1435 Gene: SH0416: uroporphyrin-III C-methyltransferase	Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 Gene: SSP2406: uroporphyrin-III C-methyltransferase	Macrococcus caseolyticus JCSC5402	uroporphyrin-III C-methyltransferase
SSP2405	Staphylococcus aureus subsp. aureus N315	Staphylococcus capitis SK14	Staphylococcus epidermidis ATCC 12228	Staphylococcus carnosus subsp. carnosus TM300	Staphylococcus haemolyticus JCSC1435	Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 Gene: SSP2405: sirohydrochlorin ferrochelatase	Macrococcus caseolyticus JCSC5402	sirohydrochlorin ferrochelatase
sirC	Staphylococcus aureus subsp. aureus N315 Gene: SA2412: Precorrin-2 dehydrogenase	Staphylococcus capitis SK14 Gene: STACA0001_1808: Precorrin-2 dehydrogenase	Staphylococcus epidermidis ATCC 12228 Gene: SE2177: Precorrin-2 dehydrogenase	Staphylococcus carnosus subsp. carnosus TM300	Staphylococcus haemolyticus JCSC1435 Gene: SH0417: Precorrin-2 dehydrogenase	Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 Gene: SSP2404: Precorrin-2 dehydrogenase	Macrococcus caseolyticus JCSC5402	Precorrin-2 dehydrogenase
ytnM	Staphylococcus aureus subsp. aureus N315	Staphylococcus capitis SK14 Gene: STACA0001_1807: conserved membrane protein YtnM	Staphylococcus epidermidis ATCC 12228 Gene: SE2176: conserved membrane protein YtnM	* Staphylococcus carnosus subsp. carnosus TM300 Site: position = -105 score = 5.35107 sequence = TAAATCCTTGTAAACCAATAAGAATAA Gene: Sca_0062: conserved membrane protein YtnM	Staphylococcus haemolyticus JCSC1435 Gene: SH0418: conserved membrane protein YtnM	Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 Gene: SSP2403: conserved membrane protein YtnM	Macrococcus caseolyticus JCSC5402	conserved membrane protein YtnM
cysD	Staphylococcus aureus subsp. aureus N315	Staphylococcus capitis SK14 Gene: STACA0001_1806: sulfate adenylyltransferase	Staphylococcus epidermidis ATCC 12228 Gene: SE2175: sulfate adenylyltransferase	Staphylococcus carnosus subsp. carnosus TM300 Gene: Sca_0063: sulfate adenylyltransferase	* Staphylococcus haemolyticus JCSC1435 Site: position = -48 score = 4.87171 sequence = TAAAACCGAGTAAACTAATCTAATTAA Gene: SH0419: sulfate adenylyltransferase	Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 Gene: SSP2402: sulfate adenylyltransferase	Macrococcus caseolyticus JCSC5402	sulfate adenylyltransferase
cysC	Staphylococcus aureus subsp. aureus N315	Staphylococcus capitis SK14 Gene: STACA0001_1805: adenylylsulfate kinase	Staphylococcus epidermidis ATCC 12228 Gene: SE2174: adenylylsulfate kinase	Staphylococcus carnosus subsp. carnosus TM300 Gene: Sca_0064: adenylylsulfate kinase	Staphylococcus haemolyticus JCSC1435 Gene: SH0420: adenylylsulfate kinase	Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 Gene: SSP2401: adenylylsulfate kinase	Macrococcus caseolyticus JCSC5402	adenylylsulfate kinase
cysH	Staphylococcus aureus subsp. aureus N315	* Staphylococcus capitis SK14 Site: position = -71 score = 5.50752 sequence = TTATTCTGACAATTCAGATAGGAATTT Gene: STACA0001_1812: phosphoadenosine phosphosulfate reductase	* Staphylococcus epidermidis ATCC 12228 Site: position = -68 score = 4.98385 sequence = TTATTCTGACAATTCTGATATGTTTTG Gene: SE2181: phosphoadenosine phosphosulfate reductase	Staphylococcus carnosus subsp. carnosus TM300 Gene: Sca_0058: phosphoadenosine phosphosulfate reductase	* Staphylococcus haemolyticus JCSC1435 Site: position = -68 score = 5.56749 sequence = TTATTCTGACAATTCTGATAGGTATTA Gene: SH0413: phosphoadenosine phosphosulfate reductase	Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 Gene: SSP2409: phosphoadenosine phosphosulfate reductase	Macrococcus caseolyticus JCSC5402	phosphoadenosine phosphosulfate reductase

Export

	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD