Regulon of CymR in Staphylococcus haemolyticus JCSC1435

Properties
Regulator type:	Transcription factor
TF locus tag:	SH1294
Regulator family:	Rrf2
Regulation mode:	repressor
Biological process:	Cysteine metabolism
Effector:	O-acetyl-L-serine; CysK, cysteine synthetase
Regulog:	CymR - Staphylococcaceae
Statistics of regulated genes:
- Genes	17
- Operons	8
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 69 sites [see more]

Member of regulog collections

By taxonomy - Staphylococcaceae
By TF family - Rrf2
By effector - O-acetyl-L-serine
By effector - CysK, cysteine synthetase
By pathway - Cysteine metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -49 Score: 5.4 Sequence: TTATCCTTATTAAGTATGTCGGAATTA Locus tag: SH2589 Name: tcyP Funciton: L-cystine uptake protein tcyP
	SH2589	tcyP	L-cystine uptake protein tcyP
Position: -41 Score: 5.9 Sequence: TTATTCTGACTAATCTAATAGGAATAT Locus tag: SH0639 Name: tcyA Funciton: L-cystine uptake ABC transporter, L-cystine-binding protein TcyA Locus tag: SH0640 Name: tcyB Funciton: L-cystine uptake ABC transporter, permease protein TcyB Locus tag: SH0641 Name: tcyC Funciton: L-cystine uptake ABC transporter, ATP-binding protein TcyC
	SH0639	tcyA	L-cystine uptake ABC transporter, L-cystine-binding protein TcyA
	SH0640	tcyB	L-cystine uptake ABC transporter, permease protein TcyB
	SH0641	tcyC	L-cystine uptake ABC transporter, ATP-binding protein TcyC
Position: -266 Score: 4.4 Sequence: TAATGTCGAGTGATAAACTAGGTTTAA Locus tag: SH0767 Name: SA2080 Funciton: putative acyl-CoA dehydrogenase
	SH0767	SA2080	putative acyl-CoA dehydrogenase
Position: -182 Score: 5.6 Sequence: TAATTATTACTTATTTTATCGGATTTA Locus tag: SH0901 Name: luxS Funciton: S-ribosylhomocysteinase
	SH0901	luxS	S-ribosylhomocysteinase
Position: -109 Score: 5.4 Sequence: TAATTCATAGTGATTGAGTAAGAATTA Locus tag: SH2549 Name: mccA Funciton: cystathionine beta-synthase Locus tag: SH2548 Name: mccB Funciton: cystathionine gamma-lyase
	SH2549	mccA	cystathionine beta-synthase
	SH2548	mccB	cystathionine gamma-lyase
Position: -56 Score: 4.9 Sequence: TATATCCGATAGAAAAACTAAGTTTTA Locus tag: SH2497 Name: cysK Funciton: cysteine synthase
	SH2497	cysK	cysteine synthase
Position: -48 Score: 4.9 Sequence: TAAAACCGAGTAAACTAATCTAATTAA Locus tag: SH0419 Name: cysD Funciton: sulfate adenylyltransferase Locus tag: SH0420 Name: cysC Funciton: adenylylsulfate kinase
	SH0419	cysD	sulfate adenylyltransferase
	SH0420	cysC	adenylylsulfate kinase
Position: -152 Score: 4.5 Sequence: TAAAACATAGTATTCTGATATGTTTTG Position: -68 Score: 5.6 Sequence: TTATTCTGACAATTCTGATAGGTATTA Locus tag: SH0413 Name: cysH Funciton: phosphoadenosine phosphosulfate reductase Locus tag: SH0414 Name: cysJ Funciton: sulfite reductase [NADPH] flavoprotein, alpha-component Locus tag: SH0415 Name: cysI Funciton: sulfite reductase (NADPH) hemoprotein, beta-component Locus tag: SH0416 Name: cysG Funciton: uroporphyrin-III C-methyltransferase Locus tag: SH0417 Name: sirC Funciton: Precorrin-2 dehydrogenase Locus tag: SH0418 Name: ytnM Funciton: conserved membrane protein YtnM
	SH0413	cysH	phosphoadenosine phosphosulfate reductase
	SH0414	cysJ	sulfite reductase [NADPH] flavoprotein, alpha-component
	SH0415	cysI	sulfite reductase (NADPH) hemoprotein, beta-component
	SH0416	cysG	uroporphyrin-III C-methyltransferase
	SH0417	sirC	Precorrin-2 dehydrogenase
	SH0418	ytnM	conserved membrane protein YtnM

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of CymR in Staphylococcus haemolyticus JCSC1435

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --