Regulon of CymR in Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Properties
Regulator type:	Transcription factor
TF locus tag:	SSP1133
Regulator family:	Rrf2
Regulation mode:	repressor
Biological process:	Cysteine metabolism
Effector:	O-acetyl-L-serine; CysK, cysteine synthetase
Regulog:	CymR - Staphylococcaceae
Statistics of regulated genes:
- Genes	23
- Operons	10
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 69 sites [see more]

Member of regulog collections

By taxonomy - Staphylococcaceae
By TF family - Rrf2
By effector - O-acetyl-L-serine
By effector - CysK, cysteine synthetase
By pathway - Cysteine metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -63 Score: 4.6 Sequence: ATATCCTTAGTATACGTATCGGATTTC Locus tag: SSP2329 Name: tcyP Funciton: L-cystine uptake protein tcyP
	SSP2329	tcyP	L-cystine uptake protein tcyP
Position: -37 Score: 5.8 Sequence: TTATTCCGATAAGAATAATAAGAATAG Locus tag: SSP0242 Name: tcyA Funciton: L-cystine uptake ABC transporter, L-cystine-binding protein TcyA Locus tag: SSP0243 Name: tcyB Funciton: L-cystine uptake ABC transporter, permease protein TcyB Locus tag: SSP0244 Name: tcyC Funciton: L-cystine uptake ABC transporter, ATP-binding protein TcyC
	SSP0242	tcyA	L-cystine uptake ABC transporter, L-cystine-binding protein TcyA
	SSP0243	tcyB	L-cystine uptake ABC transporter, permease protein TcyB
	SSP0244	tcyC	L-cystine uptake ABC transporter, ATP-binding protein TcyC
Position: -41 Score: 5.7 Sequence: CAATTCTTATTAAAACGATAAGAATAA Locus tag: SSP0459 Name: ssuB Funciton: sulfonate ABC transporter, ATPase component Locus tag: SSP0458 Name: ssuA Funciton: sulfonate ABC transporter, substrate-binding component Locus tag: SSP0457 Name: ssuC Funciton: sulfonate ABC transporter, permease component Locus tag: SSP0456 Name: SA0169 Funciton: putative acyl-CoA dehydrogenase
	SSP0459	ssuB	sulfonate ABC transporter, ATPase component
	SSP0458	ssuA	sulfonate ABC transporter, substrate-binding component
	SSP0457	ssuC	sulfonate ABC transporter, permease component
	SSP0456	SA0169	putative acyl-CoA dehydrogenase
Position: -110 Score: 5.1 Sequence: TAAATCTTATCGGTAAAGTAAGGATTT Locus tag: SSP0622 Name: SA2080 Funciton: putative acyl-CoA dehydrogenase
	SSP0622	SA2080	putative acyl-CoA dehydrogenase
Position: -37 Score: 5.1 Sequence: TTAATCTTATTGATTTTATCGGGAAAG Locus tag: SSP0834 Name: SA1850 Funciton: putative transporter for thiosulphate
	SSP0834	SA1850	putative transporter for thiosulphate
Position: -69 Score: 4.8 Sequence: CATATCCTTGTAATCTGATAAGATTTA Locus tag: SSP0460 Name: SA0165 Funciton: hypothetical protein
	SSP0460	SA0165	hypothetical protein
Position: -159 Score: 5.1 Sequence: TAATTATTACTTATTCTATCGGGTTTA Locus tag: SSP0751 Name: luxS Funciton: S-ribosylhomocysteinase
	SSP0751	luxS	S-ribosylhomocysteinase
Position: -144 Score: 5.1 Sequence: GTATGCTTACTGAAAAAGTAGGAATTA Position: -57 Score: 5 Sequence: TAATTCTTATCGGTATAGTAAGGTATT Locus tag: SSP0252 Name: mccA Funciton: cystathionine beta-synthase Locus tag: SSP0253 Name: mccB Funciton: cystathionine gamma-lyase
	SSP0252	mccA	cystathionine beta-synthase
	SSP0253	mccB	cystathionine gamma-lyase
Position: -55 Score: 5.1 Sequence: TATATCCGATTGAAAAAGTAGGTTTTA Locus tag: SSP2243 Name: cysK Funciton: cysteine synthase
	SSP2243	cysK	cysteine synthase
Position: -152 Score: 4.5 Sequence: AATAACCTAGTATTCGTATCGGAAATA Position: -58 Score: 4.6 Sequence: TTAAACCTATTTAGACAATAATTATAA Locus tag: SSP2408 Name: cysJ Funciton: sulfite reductase [NADPH] flavoprotein, alpha-component Locus tag: SSP2407 Name: cysI Funciton: sulfite reductase (NADPH) hemoprotein, beta-component Locus tag: SSP2406 Name: cysG Funciton: uroporphyrin-III C-methyltransferase Locus tag: SSP2405 Name: SSP2405 Funciton: sirohydrochlorin ferrochelatase Locus tag: SSP2404 Name: sirC Funciton: Precorrin-2 dehydrogenase Locus tag: SSP2403 Name: ytnM Funciton: conserved membrane protein YtnM Locus tag: SSP2402 Name: cysD Funciton: sulfate adenylyltransferase Locus tag: SSP2401 Name: cysC Funciton: adenylylsulfate kinase
	SSP2408	cysJ	sulfite reductase [NADPH] flavoprotein, alpha-component
	SSP2407	cysI	sulfite reductase (NADPH) hemoprotein, beta-component
	SSP2406	cysG	uroporphyrin-III C-methyltransferase
	SSP2405	SSP2405	sirohydrochlorin ferrochelatase
	SSP2404	sirC	Precorrin-2 dehydrogenase
	SSP2403	ytnM	conserved membrane protein YtnM
	SSP2402	cysD	sulfate adenylyltransferase
	SSP2401	cysC	adenylylsulfate kinase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of CymR in Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --