Regulon of CymR in Staphylococcus epidermidis ATCC 12228

Properties
Regulator type:	Transcription factor
TF locus tag:	SE1308
Regulator family:	Rrf2
Regulation mode:	repressor
Biological process:	Cysteine metabolism
Effector:	O-acetyl-L-serine; CysK, cysteine synthetase
Regulog:	CymR - Staphylococcaceae
Statistics of regulated genes:
- Genes	21
- Operons	10
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 69 sites [see more]

Member of regulog collections

By taxonomy - Staphylococcaceae
By TF family - Rrf2
By effector - O-acetyl-L-serine
By effector - CysK, cysteine synthetase
By pathway - Cysteine metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -56 Score: 5.3 Sequence: TTATTCTTATTACATATGTCGGAATAC Locus tag: SE2354 Name: tcyP Funciton: L-cystine uptake protein tcyP
	SE2354	tcyP	L-cystine uptake protein tcyP
Position: -40 Score: 6.2 Sequence: TTATTCCGATTAGAATAATAAGAATAA Locus tag: SE1993 Name: tcyA Funciton: L-cystine uptake ABC transporter, L-cystine-binding protein TcyA Locus tag: SE1992 Name: tcyB Funciton: L-cystine uptake ABC transporter, permease protein TcyB Locus tag: SE1991 Name: tcyC Funciton: L-cystine uptake ABC transporter, ATP-binding protein TcyC
	SE1993	tcyA	L-cystine uptake ABC transporter, L-cystine-binding protein TcyA
	SE1992	tcyB	L-cystine uptake ABC transporter, permease protein TcyB
	SE1991	tcyC	L-cystine uptake ABC transporter, ATP-binding protein TcyC
Position: -65 Score: 4.4 Sequence: TAAAGTCGAGTGTTAAACTATGAATAA Locus tag: SE1858 Name: SA2080 Funciton: putative acyl-CoA dehydrogenase
	SE1858	SA2080	putative acyl-CoA dehydrogenase
Position: -35 Score: 4.6 Sequence: AATACCTTAGTATTTATATCGGAAAAG Locus tag: SE1646 Name: SA1850 Funciton: putative transporter for thiosulphate
	SE1646	SA1850	putative transporter for thiosulphate
Position: -42 Score: 5.3 Sequence: ATATTCAGATAATTTTAATCGGAAATT Locus tag: SE2322 Name: metN2 Funciton: methionine ABC transporter paralog, ATP-binding protein MetN2 Locus tag: SE2321 Name: metP2 Funciton: methionine ABC transporter paralog, permease protein MetP2 Locus tag: SE2320 Name: metQ2 Funciton: methionine ABC transporter paralog, substrate-binding protein MetQ2
	SE2322	metN2	methionine ABC transporter paralog, ATP-binding protein MetN2
	SE2321	metP2	methionine ABC transporter paralog, permease protein MetP2
	SE2320	metQ2	methionine ABC transporter paralog, substrate-binding protein MetQ2
Position: -182 Score: 5.6 Sequence: TAATTATTACTTATTTTATCGGATTTA Locus tag: SE1732 Name: luxS Funciton: S-ribosylhomocysteinase
	SE1732	luxS	S-ribosylhomocysteinase
Position: -96 Score: 5.7 Sequence: TAATTCATATCTGATAAGTAAGAATTA Locus tag: SE2324 Name: mccA Funciton: cystathionine beta-synthase Locus tag: SE2323 Name: mccB Funciton: cystathionine gamma-lyase
	SE2324	mccA	cystathionine beta-synthase
	SE2323	mccB	cystathionine gamma-lyase
Position: -58 Score: 4.8 Sequence: TATATCCGATAGAAAAACTAAGTATTG Locus tag: SE2270 Name: cysK Funciton: cysteine synthase
	SE2270	cysK	cysteine synthase
Position: -273 Score: 4.7 Sequence: CAAAACATAGTATTCCGATAAGAAATA Locus tag: SE2180 Name: cysJ Funciton: sulfite reductase [NADPH] flavoprotein, alpha-component Locus tag: SE2179 Name: cysI Funciton: sulfite reductase (NADPH) hemoprotein, beta-component Locus tag: SE2178 Name: cysG Funciton: uroporphyrin-III C-methyltransferase Locus tag: SE2177 Name: sirC Funciton: Precorrin-2 dehydrogenase Locus tag: SE2176 Name: ytnM Funciton: conserved membrane protein YtnM Locus tag: SE2175 Name: cysD Funciton: sulfate adenylyltransferase Locus tag: SE2174 Name: cysC Funciton: adenylylsulfate kinase
	SE2180	cysJ	sulfite reductase [NADPH] flavoprotein, alpha-component
	SE2179	cysI	sulfite reductase (NADPH) hemoprotein, beta-component
	SE2178	cysG	uroporphyrin-III C-methyltransferase
	SE2177	sirC	Precorrin-2 dehydrogenase
	SE2176	ytnM	conserved membrane protein YtnM
	SE2175	cysD	sulfate adenylyltransferase
	SE2174	cysC	adenylylsulfate kinase
Position: -68 Score: 5 Sequence: TTATTCTGACAATTCTGATATGTTTTG Locus tag: SE2181 Name: cysH Funciton: phosphoadenosine phosphosulfate reductase
	SE2181	cysH	phosphoadenosine phosphosulfate reductase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of CymR in Staphylococcus epidermidis ATCC 12228

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --