Orthologous regulated operons containing SSP2405 gene

Properties
Regulog:	CymR - Staphylococcaceae
Regulator type:	Transcription factor
Regulator family:	Rrf2
Regulation mode:	repressor
Biological process:	Cysteine metabolism
Effector:	O-acetyl-L-serine; CysK, cysteine synthetase
Phylum:	Firmicutes

Built upon 69 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
Position: -152 Score: 4.52675 Sequence: AATAACCTAGTATTCGTATCGGAAATA Position: -58 Score: 4.58672 Sequence: TTAAACCTATTTAGACAATAATTATAA Locus tag: SSP2408 Name: cysJ Funciton: sulfite reductase [NADPH] flavoprotein, alpha-component Locus tag: SSP2407 Name: cysI Funciton: sulfite reductase (NADPH) hemoprotein, beta-component Locus tag: SSP2406 Name: cysG Funciton: uroporphyrin-III C-methyltransferase Locus tag: SSP2405 Name: SSP2405 Funciton: sirohydrochlorin ferrochelatase Locus tag: SSP2404 Name: sirC Funciton: Precorrin-2 dehydrogenase Locus tag: SSP2403 Name: ytnM Funciton: conserved membrane protein YtnM Locus tag: SSP2402 Name: cysD Funciton: sulfate adenylyltransferase Locus tag: SSP2401 Name: cysC Funciton: adenylylsulfate kinase
cysJ-cysI-cysG-SSP2405-sirC-ytnM-cysD-cysC	-152	4.5	AATAACCTAGTATTCGTATCGGAAATA	SSP2408
	-58	4.6	TTAAACCTATTTAGACAATAATTATAA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --