Regulon of CymR in Staphylococcus aureus subsp. aureus N315

Properties
Regulator type:	Transcription factor
TF locus tag:	SA1453
Regulator family:	Rrf2
Regulation mode:	repressor
Biological process:	Cysteine metabolism
Effector:	O-acetyl-L-serine; CysK, cysteine synthetase
Regulog:	CymR - Staphylococcaceae
Statistics of regulated genes:
- Genes	21
- Operons	12
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 69 sites [see more]

Member of regulog collections

By taxonomy - Staphylococcaceae
By TF family - Rrf2
By effector - O-acetyl-L-serine
By effector - CysK, cysteine synthetase
By pathway - Cysteine metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -54 Score: 5.8 Sequence: TTATTCTTAGCATACTAGTCGGAATTA Locus tag: SA0368 Name: tcyP Funciton: L-cystine uptake protein tcyP
	SA0368	tcyP	L-cystine uptake protein tcyP
Position: -40 Score: 6.2 Sequence: TTATTCCGATTAGAATAATAAGAATAA Locus tag: SA2202 Name: tcyA Funciton: L-cystine uptake ABC transporter, L-cystine-binding protein TcyA Locus tag: SA2201 Name: tcyB Funciton: L-cystine uptake ABC transporter, permease protein TcyB Locus tag: SA2200 Name: tcyC Funciton: L-cystine uptake ABC transporter, ATP-binding protein TcyC
	SA2202	tcyA	L-cystine uptake ABC transporter, L-cystine-binding protein TcyA
	SA2201	tcyB	L-cystine uptake ABC transporter, permease protein TcyB
	SA2200	tcyC	L-cystine uptake ABC transporter, ATP-binding protein TcyC
Position: -41 Score: 6 Sequence: TAATTCCTATTAAAATAGTAGGGATTA Locus tag: SA0166 Name: ssuB Funciton: sulfonate ABC transporter, ATPase component Locus tag: SA0167 Name: ssuA Funciton: sulfonate ABC transporter, substrate-binding component Locus tag: SA0168 Name: ssuC Funciton: sulfonate ABC transporter, permease component Locus tag: SA0169 Name: SA0169 Funciton: putative acyl-CoA dehydrogenase
	SA0166	ssuB	sulfonate ABC transporter, ATPase component
	SA0167	ssuA	sulfonate ABC transporter, substrate-binding component
	SA0168	ssuC	sulfonate ABC transporter, permease component
	SA0169	SA0169	putative acyl-CoA dehydrogenase
Position: -62 Score: 4.6 Sequence: TAAAGTCGAGTGTTAAACTAGGAATAA Locus tag: SA2080 Name: SA2080 Funciton: putative acyl-CoA dehydrogenase
	SA2080	SA2080	putative acyl-CoA dehydrogenase
Position: -40 Score: 5.2 Sequence: TAATACATACTAAACTTATCGGAAATG Locus tag: SA1850 Name: SA1850 Funciton: putative transporter for thiosulphate
	SA1850	SA1850	putative transporter for thiosulphate
Position: -77 Score: 4.8 Sequence: TAATCTTGAGTAGATTACTATGATATA Locus tag: SA0198 Name: SA0198 Funciton: oligopeptide transport ATP-binding protein
	SA0198	SA0198	oligopeptide transport ATP-binding protein
Position: -59 Score: 4.9 Sequence: GTAATCCGATAAGAATTATAGTAATAT Locus tag: SA0165 Name: SA0165 Funciton: hypothetical protein
	SA0165	SA0165	hypothetical protein
Position: -42 Score: 5.8 Sequence: TTATTCCTAGTGGATTAATAAGAATTT Locus tag: SA0420 Name: metN2 Funciton: methionine ABC transporter paralog, ATP-binding protein MetN2 Locus tag: SA0421 Name: metP2 Funciton: methionine ABC transporter paralog, permease protein MetP2 Locus tag: SA0422 Name: metQ2 Funciton: methionine ABC transporter paralog, substrate-binding protein MetQ2
	SA0420	metN2	methionine ABC transporter paralog, ATP-binding protein MetN2
	SA0421	metP2	methionine ABC transporter paralog, permease protein MetP2
	SA0422	metQ2	methionine ABC transporter paralog, substrate-binding protein MetQ2
Position: -244 Score: 4.8 Sequence: GAATTATTACTTATTCTATCGGTTTTA Locus tag: SA1936 Name: luxS Funciton: S-ribosylhomocysteinase
	SA1936	luxS	S-ribosylhomocysteinase
Position: -88 Score: 5.8 Sequence: TAATTCTTATCTGAAAAGTAAGAATTA Locus tag: SA0418 Name: mccA Funciton: cystathionine beta-synthase Locus tag: SA0419 Name: mccB Funciton: cystathionine gamma-lyase
	SA0418	mccA	cystathionine beta-synthase
	SA0419	mccB	cystathionine gamma-lyase
Position: -55 Score: 5.1 Sequence: TATATCCGATAAATAAACTAAGATTTC Locus tag: SA0471 Name: cysK Funciton: cysteine synthase
	SA0471	cysK	cysteine synthase
Position: -257 Score: 4.7 Sequence: TAATAAATAGTAAATAAATAAAAAATA Locus tag: SA2413 Name: cysJ Funciton: sulfite reductase [NADPH] flavoprotein, alpha-component Locus tag: SA2412 Name: sirC Funciton: Precorrin-2 dehydrogenase
	SA2413	cysJ	sulfite reductase [NADPH] flavoprotein, alpha-component
	SA2412	sirC	Precorrin-2 dehydrogenase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of CymR in Staphylococcus aureus subsp. aureus N315

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --