Regulon of CymR in Staphylococcus carnosus subsp. carnosus TM300

Properties
Regulator type:	Transcription factor
TF locus tag:	Sca_1238
Regulator family:	Rrf2
Regulation mode:	repressor
Biological process:	Cysteine metabolism
Effector:	O-acetyl-L-serine; CysK, cysteine synthetase
Regulog:	CymR - Staphylococcaceae
Statistics of regulated genes:
- Genes	16
- Operons	9
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 69 sites [see more]

Member of regulog collections

By taxonomy - Staphylococcaceae
By TF family - Rrf2
By effector - O-acetyl-L-serine
By effector - CysK, cysteine synthetase
By pathway - Cysteine metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -269 Score: 5 Sequence: TAAATACGATATATTTACTAAGGATTT Position: -151 Score: 4.3 Sequence: TTTTACCTACATAACTACTATTTAAAA Locus tag: Sca_0042 Name: tcyP Funciton: L-cystine uptake protein tcyP
	Sca_0042	tcyP	L-cystine uptake protein tcyP
Position: -40 Score: 5.4 Sequence: TTATTCCGATGAGAATGATAAGGATAA Locus tag: Sca_1910 Name: tcyA Funciton: L-cystine uptake ABC transporter, L-cystine-binding protein TcyA Locus tag: Sca_1909 Name: tcyB Funciton: L-cystine uptake ABC transporter, permease protein TcyB Locus tag: Sca_1908 Name: tcyC Funciton: L-cystine uptake ABC transporter, ATP-binding protein TcyC
	Sca_1910	tcyA	L-cystine uptake ABC transporter, L-cystine-binding protein TcyA
	Sca_1909	tcyB	L-cystine uptake ABC transporter, permease protein TcyB
	Sca_1908	tcyC	L-cystine uptake ABC transporter, ATP-binding protein TcyC
Position: -56 Score: 4.4 Sequence: TTAATCCGAGTGATACACTAAACTTAA Locus tag: Sca_1777 Name: SA2080 Funciton: putative acyl-CoA dehydrogenase
	Sca_1777	SA2080	putative acyl-CoA dehydrogenase
Position: -38 Score: 4.8 Sequence: TAAAACTTACTAACATTATCGGAAAAG Locus tag: Sca_1551 Name: SA1850 Funciton: putative transporter for thiosulphate
	Sca_1551	SA1850	putative transporter for thiosulphate
Position: -110 Score: 4.7 Sequence: TTATCCCGAGTAAACTTATCAACTTAA Locus tag: Sca_1637 Name: luxS Funciton: S-ribosylhomocysteinase
	Sca_1637	luxS	S-ribosylhomocysteinase
Position: -92 Score: 5.6 Sequence: TAATCCATATCAGTATAGTAGGAATAA Locus tag: Sca_0086 Name: mccA Funciton: cystathionine beta-synthase Locus tag: Sca_0087 Name: mccB Funciton: cystathionine gamma-lyase
	Sca_0086	mccA	cystathionine beta-synthase
	Sca_0087	mccB	cystathionine gamma-lyase
Position: -143 Score: 4.4 Sequence: GATATCCGATGAAATAGCTAAGATATA Locus tag: Sca_0164 Name: cysK Funciton: cysteine synthase
	Sca_0164	cysK	cysteine synthase
Position: -105 Score: 5.4 Sequence: TAAATCCTTGTAAACCAATAAGAATAA Locus tag: Sca_0062 Name: ytnM Funciton: conserved membrane protein YtnM Locus tag: Sca_0063 Name: cysD Funciton: sulfate adenylyltransferase Locus tag: Sca_0064 Name: cysC Funciton: adenylylsulfate kinase
	Sca_0062	ytnM	conserved membrane protein YtnM
	Sca_0063	cysD	sulfate adenylyltransferase
	Sca_0064	cysC	adenylylsulfate kinase
Position: -134 Score: 5.4 Sequence: TAATTCTTAGTAAACCTATTGGAATTA Position: -52 Score: 5.9 Sequence: TAATTCCTACTAAAAAACTAAGAATAA Locus tag: Sca_0059 Name: cysJ Funciton: sulfite reductase [NADPH] flavoprotein, alpha-component Locus tag: Sca_0060 Name: cysI Funciton: sulfite reductase (NADPH) hemoprotein, beta-component Locus tag: Sca_0061 Name: cysG Funciton: uroporphyrin-III C-methyltransferase
	Sca_0059	cysJ	sulfite reductase [NADPH] flavoprotein, alpha-component
	Sca_0060	cysI	sulfite reductase (NADPH) hemoprotein, beta-component
	Sca_0061	cysG	uroporphyrin-III C-methyltransferase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of CymR in Staphylococcus carnosus subsp. carnosus TM300

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --