Regulon of CymR in Macrococcus caseolyticus JCSC5402

Properties
Regulator type:	Transcription factor
TF locus tag:	MCCL_1264
Regulator family:	Rrf2
Regulation mode:	repressor
Biological process:	Cysteine metabolism
Effector:	O-acetyl-L-serine; CysK, cysteine synthetase
Regulog:	CymR - Staphylococcaceae
Statistics of regulated genes:
- Genes	10
- Operons	6
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 69 sites [see more]

Member of regulog collections

By taxonomy - Staphylococcaceae
By TF family - Rrf2
By effector - O-acetyl-L-serine
By effector - CysK, cysteine synthetase
By pathway - Cysteine metabolism

Regulated operons
	Locus Tag	Name	Function
Position: 32 Score: 5.5 Sequence: TAATTCTTAgTAtTcTtATAGGAtTac Locus tag: MCCL_0267 Name: tcyP Funciton: L-cystine uptake protein tcyP
	MCCL_0267	tcyP	L-cystine uptake protein tcyP
Position: -38 Score: 5.3 Sequence: CTATTCCGAGTAAATTGATATGAATAG Locus tag: MCCL_1425 Name: tcyA Funciton: L-cystine uptake ABC transporter, L-cystine-binding protein TcyA Locus tag: MCCL_1424 Name: tcyB Funciton: L-cystine uptake ABC transporter, permease protein TcyB Locus tag: MCCL_1423 Name: tcyC Funciton: L-cystine uptake ABC transporter, ATP-binding protein TcyC
	MCCL_1425	tcyA	L-cystine uptake ABC transporter, L-cystine-binding protein TcyA
	MCCL_1424	tcyB	L-cystine uptake ABC transporter, permease protein TcyB
	MCCL_1423	tcyC	L-cystine uptake ABC transporter, ATP-binding protein TcyC
Position: -256 Score: 4.5 Sequence: TATTTCCTAGATAATAAATAATGTATT Locus tag: MCCL_0131 Name: SA2080 Funciton: putative acyl-CoA dehydrogenase
	MCCL_0131	SA2080	putative acyl-CoA dehydrogenase
Position: -40 Score: 5.8 Sequence: TATTTCTTACTAAATCTATCGGAATTA Locus tag: MCCL_0379 Name: SA1850 Funciton: putative transporter for thiosulphate
	MCCL_0379	SA1850	putative transporter for thiosulphate
Position: -46 Score: 5.6 Sequence: TAATCCCGAGTTATCTGATAAGAATAA Locus tag: MCCL_1789 Name: mccA Funciton: cystathionine beta-synthase Locus tag: MCCL_1790 Name: mccB Funciton: cystathionine gamma-lyase Locus tag: MCCL_1791 Name: luxS Funciton: S-ribosylhomocysteinase
	MCCL_1789	mccA	cystathionine beta-synthase
	MCCL_1790	mccB	cystathionine gamma-lyase
	MCCL_1791	luxS	S-ribosylhomocysteinase
Position: -50 Score: 5.4 Sequence: TAAATCCGATAAGCGTAATAAGAATAA Locus tag: MCCL_1900 Name: cysK Funciton: cysteine synthase
	MCCL_1900	cysK	cysteine synthase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD