Regulog BirA - Staphylococcaceae
| Regulator type: | Transcription factor |
| Regulator family: | BirA |
| Regulation mode: | repressor |
| Biological process: | Biotin biosynthesis |
| Effector: | Biotin |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Staphylococcaceae
- By trascription factor - BirA
- By TF family - BirA
- By effector - Biotin
- By pathway - Biotin biosynthesis
| Genome | Genes | Operons |
|---|---|---|
| Staphylococcus aureus subsp. aureus N315 | 12 | 3 |
| Staphylococcus capitis SK14 | 8 | 3 |
| Staphylococcus epidermidis ATCC 12228 | 12 | 4 |
| Staphylococcus carnosus subsp. carnosus TM300 | 7 | 4 |
| Staphylococcus haemolyticus JCSC1435 | 7 | 3 |
| Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 | 6 | 2 |
| Macrococcus caseolyticus JCSC5402 | 2 | 2 |
| Genes | Function | |||||||
|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||
| yhfT |
*
Staphylococcus aureus subsp. aureus N315 Site: position = -48 score = 7.06964 sequence = AATGTTAACAAGATGTATTTTAAAGTTTACATT Gene: SA0533: putative long chain fatty acid-CoA ligase |
*
Staphylococcus capitis SK14 Site: position = -43 score = 7.17092 sequence = AATGTTAACATATTTATAAATATAGTTTACATA Gene: STACA0001_0458: putative long chain fatty acid-CoA ligase |
*
Staphylococcus epidermidis ATCC 12228 Site: position = -44 score = 7.05411 sequence = AATGTAAACATAATTATATAAAGTGTTTACAAA Gene: SE0344: putative long chain fatty acid-CoA ligase |
Gene: Sca_2089: putative long chain fatty acid-CoA ligase |
*
Staphylococcus haemolyticus JCSC1435 Site: position = -55 score = 7.56508 sequence = AATGTTAACATAATATAAAATAAAGTTAACATT Gene: SH2418: putative long chain fatty acid-CoA ligase |
*
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 Site: position = -49 score = 6.58307 sequence = AATGTTAACATATTTGTTATGAAGGTTAACAAA Gene: SSP2146: putative long chain fatty acid-CoA ligase |
|
putative long chain fatty acid-CoA ligase |
| SE0345 |
|
|
Gene: SE0345: hypothetical protein |
|
|
|
|
hypothetical protein |
| yhfS |
Gene: SA0534: putative acetyl-CoA c-acetyltransferase |
Gene: STACA0001_0457: putative acetyl-CoA c-acetyltransferase |
Gene: SE0346: putative acetyl-CoA c-acetyltransferase |
Gene: Sca_2088: putative acetyl-CoA c-acetyltransferase |
Gene: SH2417: putative acetyl-CoA c-acetyltransferase |
Gene: SSP2145: putative acetyl-CoA c-acetyltransferase |
|
putative acetyl-CoA c-acetyltransferase |
| SA0535 |
Gene: SA0535: hypothetical protein |
Gene: STACA0001_0456: protein VraC |
Gene: SE0347: hypothetical protein |
Gene: Sca_2087: hypothetical protein |
Gene: SH2416: hypothetical protein |
Gene: SSP2144: hypothetical protein |
|
hypothetical protein |
| SA0536 |
Gene: SA0536: hypothetical protein |
Gene: STACA0001_0455: conserved hypothetical protein |
Gene: SE0348: hypothetical protein |
|
Gene: SH2415: hypothetical protein |
Gene: SSP2143: hypothetical protein |
|
hypothetical protein |
| CRON 2. | ||||||||
| pycA |
Gene: SA0963: pyruvate carboxylase |
Gene: STACA0001_2249: pyruvate carboxylase |
Gene: SE0813: pyruvate carboxylase |
*
Staphylococcus carnosus subsp. carnosus TM300 Site: position = -367 score = 7.19291 sequence = AATGTAAACTTAAAAATAAATAAAATTAACAAT Gene: Sca_0740: pyruvate carboxylase |
Gene: SH1838: pyruvate carboxylase |
Gene: SSP1675: pyruvate carboxylase |
Gene: MCCL_0729: pyruvate carboxylase |
pyruvate carboxylase |
| CRON 3. | ||||||||
| bioY |
*
Staphylococcus aureus subsp. aureus N315 Site: position = -75 score = 7.50757 sequence = ATTGTAAACTTTTCATTTCTTAAAGTTTACAAT Gene: SA2077: biotin transporter BioY |
*
Staphylococcus capitis SK14 Site: position = -70 score = 7.78149 sequence = TATGTAAACTTTTTATTTCTTAAAGTTTACATT Gene: STACA0001_1211: biotin transporter BioY |
*
Staphylococcus epidermidis ATCC 12228 Site: position = -70 score = 6.9213 sequence = ATTGTAAACTTTCCATTCATAAAAGTTTACAAG Gene: SE1856: biotin transporter BioY |
*
Staphylococcus carnosus subsp. carnosus TM300 Site: position = -75 score = 7.28465 sequence = AATGTAAACTTTTAGTAAATTCAAGTTAACAAT Gene: Sca_1775: biotin transporter BioY |
*
Staphylococcus haemolyticus JCSC1435 Site: position = -69 score = 8.17293 sequence = AATGTAAACTTTTTATTTTATAAAGTTTACATT Gene: SH0770: biotin transporter BioY |
*
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 Site: position = -67 score = 8.11648 sequence = AATGTAAACTTTTTATTTTTTAAAGTTTACATT Gene: SSP0625: biotin transporter BioY |
*
Macrococcus caseolyticus JCSC5402 Site: position = -75 score = 6.67416 sequence = ATTGTTAACTTTTTGTACTAAAAGGTTAACGAA Gene: MCCL_0134: biotin transporter BioY |
biotin transporter BioY |
| SA2076 |
Gene: SA2076: putative acetyltransferase |
Gene: STACA0001_1212: putative acetyltransferase |
Gene: SE1855: putative acetyltransferase |
Gene: Sca_1774: putative acetyltransferase |
Gene: SH0771: putative acetyltransferase |
Gene: SSP0626: putative acetyltransferase |
Gene: MCCL_1694: putative acetyltransferase |
putative acetyltransferase |
| CRON 4. | ||||||||
| bioD |
*
Staphylococcus aureus subsp. aureus N315 Site: position = -55 score = 7.94585 sequence = AATGTAAACTTATTAATTATAAAAGTTTACATT Gene: SA2215: dethiobiotin synthetase |
|
*
Staphylococcus epidermidis ATCC 12228 Site: position = -55 score = 7.7403 sequence = AATGTAAACTTTAAAATGTAATAAGTTTACATT Gene: SE0179: dethiobiotin synthetase |
Gene: Sca_2224: putative dethiobiotin synthetase |
|
|
|
dethiobiotin synthetase |
| bioA |
Gene: SA2214: adenosylmethionine-8-amino-7-oxononanoate aminotransferase |
|
Gene: SE0180: adenosylmethionine-8-amino-7-oxononanoate aminotransferase |
Gene: Sca_2223: putative adenosylmethionine-8-amino-7-oxononanoate aminotransferase |
|
|
|
adenosylmethionine-8-amino-7-oxononanoate aminotransferase |
| bioB |
Gene: SA2213: biotin synthase |
*
Staphylococcus capitis SK14 Site: position = -87 score = 7.99118 sequence = AATGTAAACTTATAAATATATAAAGTTTACATT Gene: STACA0001_0034: biotin synthase |
*
Staphylococcus epidermidis ATCC 12228 Site: position = -110 score = 7.88128 sequence = AATGTAAACTTATAAATATATAAAGTTTACAAT Gene: SE0234: biotin synthase |
*
Staphylococcus carnosus subsp. carnosus TM300 Site: position = -63 score = 7.35149 sequence = AATGTTAACTATATAAAAAAATAAGTTAACAAT Gene: Sca_2002: putative biotin synthase |
*
Staphylococcus haemolyticus JCSC1435 Site: position = -75 score = 7.96501 sequence = AATGTAAACTTATTTATATATAAAGTTTACATT Gene: SH0269: biotin synthase |
|
*
Macrococcus caseolyticus JCSC5402 Site: position = -76 score = 6.75088 sequence = ATTGTTAACTTATATTCAAAATTAGTTTACAAT Gene: MCCL_0376: biotin synthase |
biotin synthase |
| bioF |
Gene: SA2212: hypothetical protein |
|
Gene: SE0181: 8-amino-7-oxononanoate synthase |
|
|
|
|
hypothetical protein |
| bioW |
Gene: SA2211: hypothetical protein |
|
Gene: SE0182: 6-carboxyhexanoate--CoA ligase |
|
|
|
|
hypothetical protein |
| bioX |
Gene: SA2210: hypothetical protein |
|
|
|
|
|
|
hypothetical protein |
| bioY |
|
|
|
*
Staphylococcus carnosus subsp. carnosus TM300 Site: position = -73 score = 7.97202 sequence = AATGTAAACTTATAAAAATTAAAAGTTTACATT Gene: Sca_2225: putative biotin synthase |
|
|
|
putative biotin synthase |
| SA2076 |
|
Gene: STACA0001_0035: hypothetical protein |
|
|
|
|
|
hypothetical protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |