Regulon of BirA in Staphylococcus capitis SK14

Properties
Regulator type:	Transcription factor
TF locus tag:	STACA0001_1704
Regulator family:	BirA
Regulation mode:	repressor
Biological process:	Biotin biosynthesis
Effector:	Biotin
Regulog:	BirA - Staphylococcaceae
Statistics of regulated genes:
- Genes	8
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 21 sites [see more]

Member of regulog collections

By taxonomy - Staphylococcaceae
By trascription factor - BirA
By TF family - BirA
By effector - Biotin
By pathway - Biotin biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -43 Score: 7.2 Sequence: AATGTTAACATATTTATAAATATAGTTTACATA Locus tag: STACA0001_0458 Name: yhfT Funciton: putative long chain fatty acid-CoA ligase Locus tag: STACA0001_0457 Name: yhfS Funciton: putative acetyl-CoA c-acetyltransferase Locus tag: STACA0001_0456 Name: SA0535 Funciton: protein VraC Locus tag: STACA0001_0455 Name: SA0536 Funciton: conserved hypothetical protein
	STACA0001_0458	yhfT	putative long chain fatty acid-CoA ligase
	STACA0001_0457	yhfS	putative acetyl-CoA c-acetyltransferase
	STACA0001_0456	SA0535	protein VraC
	STACA0001_0455	SA0536	conserved hypothetical protein
Position: -70 Score: 7.8 Sequence: TATGTAAACTTTTTATTTCTTAAAGTTTACATT Locus tag: STACA0001_1211 Name: bioY Funciton: biotin transporter BioY Locus tag: STACA0001_1212 Name: SA2076 Funciton: putative acetyltransferase
	STACA0001_1211	bioY	biotin transporter BioY
	STACA0001_1212	SA2076	putative acetyltransferase
Position: -87 Score: 8 Sequence: AATGTAAACTTATAAATATATAAAGTTTACATT Locus tag: STACA0001_0034 Name: bioB Funciton: biotin synthase Locus tag: STACA0001_0035 Name: SA2076 Funciton: hypothetical protein
	STACA0001_0034	bioB	biotin synthase
	STACA0001_0035	SA2076	hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD