Regulon of BirA in Staphylococcus carnosus subsp. carnosus TM300

Properties
Regulator type:	Transcription factor
TF locus tag:	Sca_1090
Regulator family:	BirA
Regulation mode:	repressor
Biological process:	Biotin biosynthesis
Effector:	Biotin
Regulog:	BirA - Staphylococcaceae
Statistics of regulated genes:
- Genes	7
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 21 sites [see more]

Member of regulog collections

By taxonomy - Staphylococcaceae
By trascription factor - BirA
By TF family - BirA
By effector - Biotin
By pathway - Biotin biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -367 Score: 7.2 Sequence: AATGTAAACTTAAAAATAAATAAAATTAACAAT Locus tag: Sca_0740 Name: pycA Funciton: pyruvate carboxylase
	Sca_0740	pycA	pyruvate carboxylase
Position: -75 Score: 7.3 Sequence: AATGTAAACTTTTAGTAAATTCAAGTTAACAAT Locus tag: Sca_1775 Name: bioY Funciton: biotin transporter BioY Locus tag: Sca_1774 Name: SA2076 Funciton: putative acetyltransferase
	Sca_1775	bioY	biotin transporter BioY
	Sca_1774	SA2076	putative acetyltransferase
Position: -63 Score: 7.4 Sequence: AATGTTAACTATATAAAAAAATAAGTTAACAAT Locus tag: Sca_2002 Name: bioB Funciton: putative biotin synthase
	Sca_2002	bioB	putative biotin synthase
Position: -73 Score: 8 Sequence: AATGTAAACTTATAAAAATTAAAAGTTTACATT Locus tag: Sca_2225 Name: bioY Funciton: putative biotin synthase Locus tag: Sca_2224 Name: bioD Funciton: putative dethiobiotin synthetase Locus tag: Sca_2223 Name: bioA Funciton: putative adenosylmethionine-8-amino-7-oxononanoate aminotransferase
	Sca_2225	bioY	putative biotin synthase
	Sca_2224	bioD	putative dethiobiotin synthetase
	Sca_2223	bioA	putative adenosylmethionine-8-amino-7-oxononanoate aminotransferase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD