Regulon of BirA in Staphylococcus epidermidis ATCC 12228

Properties
Regulator type:	Transcription factor
TF locus tag:	SE1144
Regulator family:	BirA
Regulation mode:	repressor
Biological process:	Biotin biosynthesis
Effector:	Biotin
Regulog:	BirA - Staphylococcaceae
Statistics of regulated genes:
- Genes	12
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 21 sites [see more]

Member of regulog collections

By taxonomy - Staphylococcaceae
By trascription factor - BirA
By TF family - BirA
By effector - Biotin
By pathway - Biotin biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -70 Score: 6.9 Sequence: ATTGTAAACTTTCCATTCATAAAAGTTTACAAG Locus tag: SE1856 Name: bioY Funciton: biotin transporter BioY Locus tag: SE1855 Name: SA2076 Funciton: putative acetyltransferase
	SE1856	bioY	biotin transporter BioY
	SE1855	SA2076	putative acetyltransferase
Position: -110 Score: 7.9 Sequence: AATGTAAACTTATAAATATATAAAGTTTACAAT Locus tag: SE0234 Name: bioB Funciton: biotin synthase
	SE0234	bioB	biotin synthase
Position: -55 Score: 7.7 Sequence: AATGTAAACTTTAAAATGTAATAAGTTTACATT Locus tag: SE0179 Name: bioD Funciton: dethiobiotin synthetase Locus tag: SE0180 Name: bioA Funciton: adenosylmethionine-8-amino-7-oxononanoate aminotransferase Locus tag: SE0181 Name: bioF Funciton: 8-amino-7-oxononanoate synthase Locus tag: SE0182 Name: bioW Funciton: 6-carboxyhexanoate--CoA ligase
	SE0179	bioD	dethiobiotin synthetase
	SE0180	bioA	adenosylmethionine-8-amino-7-oxononanoate aminotransferase
	SE0181	bioF	8-amino-7-oxononanoate synthase
	SE0182	bioW	6-carboxyhexanoate--CoA ligase
Position: -44 Score: 7.1 Sequence: AATGTAAACATAATTATATAAAGTGTTTACAAA Locus tag: SE0344 Name: yhfT Funciton: putative long chain fatty acid-CoA ligase Locus tag: SE0345 Name: null Funciton: hypothetical protein Locus tag: SE0346 Name: yhfS Funciton: putative acetyl-CoA c-acetyltransferase Locus tag: SE0347 Name: SA0535 Funciton: hypothetical protein Locus tag: SE0348 Name: SA0536 Funciton: hypothetical protein
	SE0344	yhfT	putative long chain fatty acid-CoA ligase
	SE0345		hypothetical protein
	SE0346	yhfS	putative acetyl-CoA c-acetyltransferase
	SE0347	SA0535	hypothetical protein
	SE0348	SA0536	hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD